| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon 97331
| ABSTRACT |
|---|
|
|
|---|
A survey of the genetic diversity and population structure of the Douglas-fir Swiss needle cast pathogen Phaeocryptopus gaeumannii was conducted with single-strand conformational polymorphisms (SSCP) to screen for variability in mitochondrial and nuclear housekeeping genes. Thirty host populations representing the natural range of Douglas-fir as well as locations where the tree was planted as an exotic were sampled. Sequencing of SSCP variants revealed that the method accurately detected both single nucleotide and indel polymorphisms. Sequence information was used to construct multilocus gene genealogies and to test various hypotheses of recombination (outcrossing) and clonality (selfing). We found that P. gaeumannii in the region of Oregons Swiss needle cast epidemic exhibits strong multilocus gametic phase disequilibrium and is subdivided into two reproductively isolated sympatric lineages. Low genotypic diversity together with the presence of overrepresented genotypes in both lineages suggests a predominantly selfing reproductive mode. Genotypes of one lineage were found in isolates from a widespread geographic distribution, occurring throughout much of the Pacific Northwest as well as nonindigenous populations abroad that have historical reports of disease. Genotypes of the second lineage were detected only in isolates from Oregons coastal region. Within the main epidemic area, abundance of this second lineage in young plantations appeared to be correlated with disease severity.
Key words: Ascomycota, foliage pathogen, forest pathology, population biology, population genetics
| INTRODUCTION |
|---|
|
|
|---|
Since its initial discovery Swiss needle cast has been reported in other locations where Douglas-fir has been cultivated outside of its native range (Boyce 1940
), most recently in New Zealand (Hood and Kershaw 1975
, Hood 1997
). While the fungus apparently has long been a widespread component of the natural Douglas-fir mycobiota, Swiss needle cast disease has not been a significant problem in Pacific Northwest forests until recently, although the disease has been noted in Christmas tree plantations since the late 1970s (Hadfield and Douglas 1982
). Since about 1990 a severe epidemic of Swiss needle cast has been observed in Douglas-fir forest plantations along the Oregon coast, particularly near the town of Tillamook, and disease severity is associated with abnormally high levels of P. gaeumannii (Hansen et al 2000
, Manter et al 2005
). Aerial surveys conducted annually since 1996 by the Oregon Department of Forestry indicate nearly 160 000 ha of Douglas-fir plantations in coastal Oregon are affected by this disease (Hansen et al 2000
, A. Kanaskie, Oregon Department of Forestry, pers comm). Hypotheses proposed to account for the abrupt increase of this previously benign parasite include changes in forest management practices (Hansen et al 2000
), climatic factors (Manter et al 2005
) and the possible existence of a more virulent strain or race of the pathogen.
In attempting to reconcile the apparent harmlessness of P. gaeumannii on its host in western North America with its virulence on Douglas-fir planted in Europe, Boyce (1940)
considered the possible existence of virulent races or strains of the pathogen. Since Boyces (1940)
original description of the disease the existence of a virulent P. gaeumannii strain has been postulated often but it never has been tested. Nothing is known about fundamental life history traits of the fungus such as its genetic structure, mating system or geographic differentiation. The tools of population genetics and molecular and evolutionary biology recently have demonstrated the power that explicit tests of reproductive mode can have on understanding the diverse life histories of fungal pathogens (Taylor et al 1999
). The emerging theme is that reproductive mode (selfing or out-crossing) and reproductive morphology (sexual or asexual) are uncoupled to the extent that almost all fungi, including those with no known means of sexual reproduction, exhibit both clonal and recombining population structures in nature. Accordingly, in this paper, "reproduction by recombination is defined as the production of progeny genomes that are mixtures of genetically different parental genomes, and reproduction by clonality is defined as the production of progeny genomes that are identical to the parental genome" (Taylor et al 1999
). These two models imply genetic outcomes that are amenable to empirical tests of P. gaeumannii populations.
We have used single-strand conformation polymorphism (SSCP; Orita et al 1989
) to screen for DNA sequence variation at five loci in the P. gaeumannii genome. Hypotheses of clonality (selfing) and recombination (outcrossing) were evaluated with both population genetic and phylogenetic theory to test whether there is evidence of unrestricted gene flow throughout the entire range of the fungus or whether the species is geographically differentiated or includes reproductively isolated populations.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
DNA extraction and primer design. Cultures were prepared for DNA extraction by scraping about 30 mg mycelium from the agar surface. Collected mycelium was placed into 2.0 mL microfuge tubes with 1.0 mm zirconia/silica beads (Biospec Products, Bartlesville, Oklahoma) and 1 mL CTAB extraction buffer (2% CTAB (cetyltrimethylammonium bromide), 100 mM Tris, pH 8.0, 20 mM Na2EDTA pH 8, 1.4 M NaCl, 1% polyvinylpolypyrrolidone, 0.1% 2-mercaptoethanol) and shaken in a Mini-Beadbeater (Biospec Products) for 30 s at 5000 rpm. After mixing samples were incubated at 65 C for 2 h. The DNA was purified in 24:1 chloroform:isoamyl alcohol and further purified to reduce PCR inhibitors by passing the extract over QIAAmp Spin Columns (QIAGEN Inc., Valencia, California) according to the manufacturers instructions.
Four isolates representing geographic extremes were chosen to evaluate portions of six nuclear protein-coding genes and one mitochondrial ribosomal gene for intraspecific variation. Genes encoding the products actin (ACT),
-tubulin (ATUB), ß-tubulin (BTUB), calmodulin (CAM), chitin synthase 1 (CHS), translation elongation factor 1-alpha (TEF1), and the mitochondrial ribosomal small subunit (mtSSU) were chosen for initial examination because some regions, particularly introns, had shown variability within other species of Ascomycota (Carbone and Kohn 1999
, Geiser et al 1998
, Johannesson et al 2000
, ODonnell et al 1998
). Selected regions were amplified and sequenced with these primer pairs (5' to 3'): ACT1F, gtatgtcgaaggccggtttc and ACT1R, tagcagagcttctccttgatgtc for ACT, ATUB1F, ttgccagatcgccaactc and ATUB1R, agtggacgaaggcacgct for ATUB, T1 and T2 (ODonnell and Cigelnik 1997
) for BTUB, CAM2F, gartwcaaggaggccttctc and CAM2R, ttytgcatcatgagctggac for CAM, CS1F, gcttacgatgtayaaygaggacg and CS1R, cgagyttgtattcraarttytg for CHS, TEF1F, cgtaccatcgagaagttcga and TEF1R, tcaccagacttgatgaacttg for TEF1, and MS3F, gatgatggctctgattgaac and MS2 (White et al 1990
) for mtSSU.
PCR reactions (50 µL) were performed in 1x enzyme buffer, 200 µM dNTP, 0.4 µM forward and reverse primers, 0.05 U/µL RedTaq DNA polymerase (Sigma, St Louis, Missouri) and 20200 ng template DNA for 35 cycles of 60 s at 94 C, 60 s at 5055 C, and 60 s at 72 C. After amplification PCR products were prepared for direct sequencing by isopropanol precipitation. Cycle sequencing on both strands was performed on an ABI model 377 fluorescent sequencer (PE Applied Biosystems Inc., Foster City, California) employing dye-terminator chemistry. Contigs were assembled and the overlapping chromatograms edited with the Staden software package (Staden 1996
). Sequence alignments were generated with Clustal X (Thompson et al 1997
) and compared for regions variable among the four tester isolates. Because they were polymorphic, BTUB, mtSSU, ATUB, CHS and CAM were selected for population-level SSCP analysis. For each gene, internal priming sites (200500 base-pairs apart) were designed to span variable regions (TABLE II
). The locus specific forward and reverse primers were extended at their 5' ends with M13 universal sequencing primers. The M13 tails served as templates for a second, labeling reaction so that costs could be minimized by the purchase of only two fluorescently labeled primers (Boutin et al 1997
).
|
After PCR reactions were completed, 0.5 µL labeled products were denatured for 5 min at 95 C in 5.25 µL deionized formamide, 0.5 µL 0.3 N NaOH and 0.5 µL GeneScan-500 internal lane size standard (PE Biosystems). Samples were cooled on ice and loaded immediately onto a nondenaturing 12 cm 0.4x MDE (FMC Bioproducts, Rockland, Maine) gel amended with 10% glycerol. The first and last four lanes of each gel were loaded with the four tester isolates to serve as comparisons to identify both known and new alleles. Gels were run at 15 C at 20 W (constant limiting factor), 2000 V, 40 mA for 4.5 h on a Prism 377 Automated DNA Sequencer (PE Biosystems) set to GeneScan mode with filter set C. The gels were analyzed with GeneScan Analysis 2.0.2 software (PE Biosystems). To ensure that putative alleles inferred from patterns on SSCP gels (phenotypes) corresponded to unique nucleotide sequences, each allele was sequenced from at least three randomly chosen representatives. Where fewer than three alleles were found, all were sequenced.
Identical locus-specific amplification, labeling, SSCP and sequencing conditions as described above were used to assess variation at the ATUB, CHS and CAM loci, except that primer concentrations in the initial, locus-specific multiplex reactions were altered respectively to 0.13 µM, 0.4 µM, and 0.5 µM. This prevented shorter PCR products from depleting reagents before the longer, less efficient products could be synthesized.
Data analysis.
Because P. gaeumannii is presumed haploid with a potentially mixed reproductive mode (selfing and outcrossing), three multilocus permutation tests suitable for detecting recombination and population structure in haploid organisms were employed. All tests used the variable positions in DNA sequence data inferred from SSCP unless otherwise indicated. The multilocus index of association (IA) was used to detect correlations between alleles at different loci (i.e. gametic disequilibrium, Brown et al 1980
) to discern between the extremes of panmixia and clonality and to detect intermediate types of population structure such as an "epidemic" structure, in which one or a few genotypes are over-represented, as well as reproductive isolation between two or more otherwise recombining groups (Maynard Smith et al 1993
).
The parsimony tree length permutation test (Burt et al 1996
, Koufopanou et al 1997
) was used to estimate the probability that, by chance, two or more groups of isolates did not share polymorphisms. The null hypothesis for both tests was random recombination. The distribution of alleles (defined as nucleotide linkage groups for each locus) in sampled populations was compared to a null distribution obtained by randomly shuffling alleles among isolates by means of the computer program Multilocus v1.2 (Agapow and Burt 2001
). The null distribution was generated from 1000 randomized datasets. PAUP* 4.0b4 for Windows (Swofford 1999
) was used to compute the tree lengths of most parsimonious trees for the observed data and for the randomized datasets.
The third permutation method used the partition-homogeneity test (Farris et al 1994
, Huelsenbeck et al 1996
) as implemented in PAUP* to test the compatibility of trees constructed from different loci. Here the null hypothesis was clonality and the sum of tree lengths of individual loci was compared to a null distribution of summed tree lengths in 1000 randomized datasets where nucleotide positions were shuffled randomly among loci.
| RESULTS |
|---|
|
|
|---|
|
|
|
We used the information on genotype distribution (TABLE V
) to assume that those present in the coastal epidemic area had the opportunity for recombination, whether or not they were capable of doing so. After adjusting for overrepresented genotypes (clone-correction), we used two methods (IA and the parsimony tree length permutation test) to test explicitly for deviations from recombination and the partition-homogeneity test to test for deviations from clonality. These tests employed information from only the BTUB, mtSSU, CHS and CAM loci because ATUB was fixed in all native populations.
Multilocus gametic disequilibrium, as assessed by the IA test, differed from that expected in a single, recombining population (P = 0.003). A similar result was obtained upon repeating the analysis with allele state data instead of nucleotides partitioned into linkage groups (IA = 1.2, P = 0.002, mean IA of null distribution = 0.0).
The parsimony tree length permutation test also supported deviation from complete panmixia. Separate genealogies for each of the five loci were well resolved and of minimal length (i.e. no homoplasy). However the four most parsimonious trees based on data from all four loci (a total of eight informative sites) indicated extensive incompatibility among genealogies from different loci and subdivided genotypes into two reproductively isolated groups (FIG. 1
), hereafter designated Lineage 1 and Lineage 2. The most parsimonious trees from the combined genealogies were 11 steps in length, 3 longer than the minimum possible (1 step for each parsimony informative site = 8). Randomly shuffling the gene sequences among genotypes, leaving the linkage of nucleotides within loci intact, provided the null distribution for the recombination hypothesis. In 1000 such randomizations, 49 trees were found as short as or shorter than the observed most parsimonious trees. This provided suggestive evidence against recombination, but it could not be ruled out conclusively (P = 0.049).
|
While geographic patterns of genotype distribution in the western United States were not obvious from the raw dataset, mapping the two lineages as separate entities was revealing (FIG. 2
). Lineage 1 was the only lineage present in the four northern, interior populations and comprised the overwhelming majority (94%) of isolates from the MacDonald Forest stand in the eastern foothills of the Coast Range. It also was present in varying quantities in all populations in the epidemic area (31% to 86%). Conversely Lineage 2 was the only lineage present at the Gold Beach site on the southern Oregon coast and comprised the majority of isolates (73%) from the site near the Oregon Department of Forestry D.L. Phipps Forest Nursery. The proportion of this lineage varied (1469%) in sites within the epidemic area.
|
|
| DISCUSSION |
|---|
|
|
|---|
That P. gaeumannii sexually reproduces has never been in question; there is direct evidence wherever Douglas-fir is grown. Its ability for self-fertilization was demonstrated by (Hood 1977
) and (Winton 2001
). However the role of recombination in the life history of the fungus, before this report, has never been addressed. In early phases of data acquisition and analysis it appeared that the Swiss needle cast outbreak in Oregon might simply be explained by high levels of genetic diversity and, by implication, recombination leading to genotypes more successful under current management or environmental conditions. However the use of population genetic and phylogenetic approaches for testing hypotheses on recombination and clonality revealed unexpected results that established a much more complicated picture.
Strong multilocus gametic disequilibrium indicated that P. gaeumannii in Oregon does not comprise a single, recombining population. Although the null distribution for unlinked loci in random mating populations is expected to be centered on zero, this analysis used sequence data wherein genes were permuted as linkage groups composed of the variable nucleotides for each locus. Thus the apparent disequilibrium in the null distribution (average = 0.6) actually reflects nucleotide site linkage within loci. Subtracting the average IA of the null distribution from that observed, strong IA among loci was estimated at 1.3.
The phylogenetic approach revealed that P. gaeumannii in Oregon is subdivided into two genetically differentiated groups that occur sympatrically in many coastal Douglas-fir stands, particularly within the region of the current Swiss needle cast outbreak. Multiple gene genealogies suggest that the two groups are reproductively isolated lineages that, by both biological and phylogenetic species concepts, constitute cryptic species. However recent admixture of the two lineages in coastal forests, combined with a low outcrossing rate, might alternatively explain the absence of recombined genotypes. Laboratory crosses could demonstrate whether the ability of the two lineages to mate has been lost, but only intensive, long-term monitoring would provide relevant evidence in natural circumstances.
One lineage (Lineage 1) is widespread, occurring throughout much of the natural range of the pathogen, and its host, in Oregon and Washington. This was the sole lineage in our sampling also found in Europe and New Zealand, two regions with historical reports of disease. Most of the populations sampled in these areas harbored at least two, and usually all three, genotypes of the lineage (TABLE V
). The presence of one of these genotypes (BCBAB) in excess within the Oregon coastal epidemic area suggests reproduction by clonal processes. While the presence of overrepresented genotypes and association among alleles at different loci provide robust and significant evidence of clonal reproduction (Tibayrenc et al 1991
), these features do not rule out recombination. Whether the divergence of genotypes within lineages was the result of recombination or mutation could not be resolved with our data. Because this lineage was the sole lineage found in four healthy stands at the northeastern limits of our sampling in the native Douglas-fir range, we tentatively propose that it is endemic there.
The second lineage (Lineage 2) comprised five genotypes and was found only in western Oregon. In most of these stands it was represented by only a single genotype (TABLE V
). Maynard Smith et al (1993)
refer to this as an epidemic population structure, distinguished by the occurrence of one or a few highly successful genotypes. By the same reasoning described above this lineage might be derived from the southern end of the Oregon coast gradually decreasing in abundance northward where it is replaced by Lineage 1. The next step is to confirm these proposed origins with an expanded latitudinal and longitudinal sampling strategy in the native range of Douglas-fir.
Both lineages were found, in varying frequencies, in the most severely diseased stands between Waldport and Astoria, Oregon. Attempts to correlate the relative abundance of the two lineages with stand-level disease severity met with limited success and implicated Lineage 2 in the Tillamook epidemic. An increase in the proportion of Lineage 2, represented largely by a single genotype, in stands was correlated with reduced canopy density and a trend of increasing discoloration, two measures of disease severity. Compared to Lineage 1 twice as many Lineage 2 isolates were obtained from a random sampling within the most severely diseased sites but only about half as many from relatively healthy stands.
Although the P. gaeumannii population from New Mexico is in a natural Douglas-fir stand, it is a small, isolated population on a mountaintop at the extreme eastern margin of the Douglas-fir range. These results are consistent with the hypothesis of reduced genetic diversity in small populations due to founder events and genetic drift. Genotypes from the New York and Vermont populations also were relatively uniform. Presumably their geographic isolation from natural populations of P. gaeumannii is a barrier to gene flow and their genotypic uniformity reflects low diversity of the founding populations.
We demonstrated that the genetic diversity of the pathogen within Douglas-fir stands in Oregons epidemic is not homogeneous and all the stands we sampled in the area harbored genotypes from both lineages. The correlations we observed between symptoms of Swiss needle cast and a specific strain or lineage of P. gaeumannii were suggestive but not conclusive. The sample size we had available to make these comparisons was small. In addition disease ratings, notoriously difficult for this pathogen, were obtained at the stand level rather than tree level. However there is substantial variation in the symptoms of disease among infected trees (Hansen et al 2000
) and it might be help to determine how much of this variation can be explained by differences in pathogenicity of the two lineages or individual genotypes. Spore dispersal mechanisms and evidence of selfing suggests that individual trees are likely to be predominately infected by the same P. gaeumannii genotype. Future attempts at more detailed analyses of population structure seem crucial and should focus on the relative pathogenicity of the two lineages, their neighborhood sizes and how these variables correlate with tree-to-tree variability in disease expression in the forest.
SSCP proved efficient for screening both known and unknown single nucleotide polymorphism and indel events for more than 400 P. gaeumannii isolates. Although four PCR reactions and two gels were used to screen five genes for each individual, additional optimization of fragment lengths would have permitted all five genes to be screened in half the number of reactions and gels. In addition (Schuelke 2000
) described a nested PCR method also using fluorescent M13 primers that combines the locus-specific and labeling reactions in a single run of the thermal cycler. Combining these approaches would reduce genotyping individuals to a single PCR setup and gel. This would allow either many more individuals or loci to be assayed and could significantly increase the statistical power of results.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Corresponding author. USDA-ARS Subarctic Agricultural Research Unit, 303 ONeil Bldg., University of Alaska at Fairbanks. Fax: (541) 737-3573. E-mail: lori.winton{at}uaf.edu
| LITERATURE CITED |
|---|
|
|
|---|
Boutin P, Hani EH, Vasseur F, Roche C, Bailleul B, Hager J, Froguel P. 1997. Automated fluorescence-based screening for mutation by SSCP: use of universal M13 dye primers for labeling and detection. Biotechniques 23:358362.[Medline]
Boyce JS. 1940. A needle-cast of Douglas-fir associated with Adelopus gaeumannii. Phytopathology 30:649659.
Brown AHD, Feldman MW, Nevo E. 1980. Multilocus structure of natural populations of Hordeum spontaneum. Genetics 96:523536.
Burt A, Carter DA, Koenig GL, White TJ, Taylor JW. 1996. Molecular markers reveal cryptic sex in the human pathogen Coccidioides immitis. Proc Natl Acad Sci USA 93:770773.
Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91:553556.[CrossRef]
Farris JS, Kallersjo M, Kluge AG, Bult C. 1994. Testing significance of incongruence. Cladistics 10:315319.[CrossRef]
Gäumann E. 1930. Über eine neue Krankheit der Douglasien. Schweiz Zeitschr Forst 81:6367.
Geiser DM, Pitt JI, Taylor JW. 1998. Cryptic speciation and recombination in the aflatoxin-producing fungus Aspergillus flavus. Proc Natl Acad Sci USA 95:388393.
Hadfield J, Douglas B. 1982. Protection of Douglas-fir Christmas trees from Swiss needle cast in Oregon. Amer Christmas Tree J 26:3133.
Hansen EM, Stone JK, Capitano BR, Rosso P, Sutton W, Winton LM. 2000. Incidence and impacts of Swiss needle cast in forest plantations of Douglas-fir in coastal Oregon. Plant Dis 84:773778.[CrossRef]
Hood IA. (1977). Inoculation experiments with Phaeocryptopus gaeumannii on Douglas-fir seedlings. NZ J For Sci 7:7782.
. 1997. Swiss needle cast. In: Hansen EM, Lewis KJ, eds. Compendium of conifer diseases. St Paul, Minnesota: APS Press. p 5556.
, Kershaw DJ. 1975. Distribution and infection period of Phaeocryptopus gaeumannii in New Zealand. NZ J For Sci 5:201208.
Huelsenbeck JP, Bull JJ, Cunningham CW. 1996. Combining data in phylogenetic analysis. Tr Ecol Evol 11:152158.[CrossRef]
Johannesson HS, Johannesson KHP, Stenlid J. 2000. Development of primer sets to amplify fragments of conserved genes for use in population studies of the fungus Daldinia loculata. Mol Ecol 9:365378.[CrossRef][Medline]
Koufopanou V, Burt A, Taylor JW. 1997. Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccidioides immitis. Proc Natl Acad Sci USA 94:54785482.
Manter DK, Reeser PW, Stone JK. 2005. A climate based model for predicting geographic variation in Swiss needle cast severity in the Oregon Coast Range. Phytopathology 95:12561265.[Medline]
Maynard Smith J, Smith NH. 1998. Detecting recombination from gene trees. Mol Biol Evol 15:590599.[Abstract]
, , ORourke M, Spratt BG. 1993. How clonal are bacteria? Proc Nat Acad Sci USA 90:43844388.
ODonnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol Phylo Evol 7:103116.[CrossRef][Medline]
, Kistler HC, Cigelnik E, Ploetz RC. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proc Nat Acad Sci USA 95:20442049.
Orita M, Iwahana H, Kanazawa H, Kayashi K, Sekiya T. 1989. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Nat Acad Sci USA 86:27662770.
Schuelke M. 2000. An economic method for fluorescent labeling of PCR fragments: a poor mans approach to genotyping for research and high-throughput diagnostics. Nat Biotechnol 18:233234.[CrossRef][Medline]
Staden R. 1996. The Staden sequence analysis package. Mol Biotechnol 5:233241.[Medline]
Swofford DL. 1999. PAUP*: phylogenetic analysis using parsimony (* and other methods). Version 4.0. Sunderland, Masachusetts: Sinauer Associates.
Taylor JW, Jacobson DJ, Fisher MC. 1999. The evolution of asexual fungi: reproduction, speciation and classification. Ann Rev Phytopathol 37:197246.[CrossRef][Medline]
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acid Res 24:48764882.
Tibayrenc M, Kjellberg J, Arnaud J, Oury B, Breniere SF, Darde M, Ayala FJ. 1991. Are eukaryotic microorganisms clonal or sexual? A population genetics vantage. Proc Natl Acad Sci USA 88:5129513.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego: Academic Press. p 315322.
Winton LM. 2001. Phylogenetics, population genetics, molecular epidemiology and pathogenicity of the Douglas-fir Swiss needle cast pathogen Phaeocryptopus gaeumannii [Doctoral thesis]. Oregon State University: Corvallis,
, Manter DK, Stone JK, Hansen EM. 2003. Comparison of biochemical, molecular and visual methods to quantify Phaeocryptopus gaeumannii in Douglas-fir foliage. Phytopathology 1:121126.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |