| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Genetics and Molecular Biology Division, Institute of Biological Sciences, University of the Philippines Los Baños, College, Laguna, Philippines 4031
Koji Kageyama 1
Takahiro Asano
River Basin Research Center, Gifu University, 1-1 Yanagido, Japan 501-1193
Haruhisa Suga
Life Science Research Center, Gifu University, 1-1 Yanagido, Japan 501-1193
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Fifty-eight isolates representing 39 Pythium species and 17 isolates representing nine Phytophthora species were chosen to investigate intra- and intergeneric relationships with sequence analysis of three genomic areas. The internal transcribed spacer regions (ITS1 and ITS2), including the 5.8S gene of the ribosomal DNA were PCR amplified with the universal primers ITS1 and ITS4. On the other hand 563 bp of the cytochrome oxidase II (cox II) gene was amplified with the primer pair FM66 and FM58 for Pythium and FM75 and FM78 for Phytophthora. The 658 bp partial ß-tubulin gene was amplified with the forward primer BT5 and reverse primer BT6. Maximum parsimony analysis of the three DNA regions revealed four major clades, reflective of sporangial morphology. Clade 1 was composed of Pythium isolates that bear filamentous to lobulate sporangia. Clade 2 represents Pythium isolates that bear globose to spherical zoosporangia or spherical hyphal swellings. Meanwhile Phytophthora isolates were lumped into Clade 3 wherein the papillate, semipapillate and nonpapillate species occupied separate subclades. Lastly, Clade 4 was composed of Pythium species that bear subglobose sporangia resembling the papillate sporangia observed in Phytophthora. Hence a number of species (Ph. undulata, P. helicoides, P. ostracodes, P. oedochilum and P. vexans) have been proposed to be the elusive intermediate species in the Pythium-to-Phytophthora evolutionary line.
Key words: molecular phylogeny, oomycetes, Pythiales
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
, Erwin and Ribeiro 1996). They are known to cause seed rot, root rot, seedling damping-off, rots of lower stems, tubers and corms and soft rots of fleshy fruits in contact with the soil. Moreover Pythium spp. that are not parasitic to plants have caused diseases in fish, crustacean, humans and even other Pythium species (Kurachek and Mitchell 2000).
Over time taxonomists have changed the classification position of these genera. However it now is established clearly that these two fungal-like groups of the family Pythiaceae belong to the kingdom Chromista (Dick 1995a and b), excluded from the traditional "true fungi" of the kingdom Myceteae. They accordingly are believed to be more closely related to diatoms and brown or golden algae than to fungi. Evidence for this includes heterokont flagellation of zoospores, predominantly cellulosic cell walls, tubular cristae in the mitochondria and diploid somatic phase (Gunderson et al 1987).
Traditional taxonomy of both Pythium and Phytophthora places a lot of emphasis on a range of morphological criteria. For Pythium these include sporangial morphology (spherical, filamentous or lobulate), surface ornamentation of the oogonium (smooth or ornamental), the extent that the oospore fills the oogonium (plerotic or aplerotic), the origin and mode of attachment of the antheridia (monoclinous or diclinous), and formation of hyphal swellings (van der Plaats-Niterink 1981). For Phytophthora the basis of the most recent classification system is sporangial morphology, in particular whether the sporangia are papillate, semipapillate or nonpapillate, in combination with other characters such as antheridial type (amphigynous and/or paragynous) and breeding system (homothallic or heterothallic) (Waterhouse 1963, Stamps et al 1990). While these classification systems have proven useful to plant pathologists over the past few decades it has become obvious that several of the morphological species are polyphyletic assemblages (Irwin JAG. 1997. Biology and management of Phytophthora spp. attacking field crops in Australia. http://www.australasianplantpathologysociety.org.au/McAlpine/DM11.htm). Thus the challenge is to use criteria other than morphology that will provide a more natural classification for Pythium and Phytophthora and which will be more generally useful to plant pathologists.
Advancements in molecular methods have permitted a more rational study of phylogenetic relationships within various organisms. And among the assortment of genetic markers that have been used for oomycete phylogeny, the rapidly evolving, non-coding internal transcribed spacer regions (ITS1 and ITS2) of the ribosomal DNA seem to be one of the most popular choice primarily because of their relatively high sequence variability (Irwin 1997) and the availability of primers that would supply sequence data for a wide range of taxa (White et al 1990). These lie between two coding regions, the 18S and the 28S genes. Another coding region, the 5.8S gene, is found between the ITS1 and ITS2. Sequence analysis of these noncoding regions have been employed to study the intrageneric relationships within Pythium (Matsumoto et al 1999, Matsumoto et al 2000) and Phytophthora (Lee and Taylor 1992, Crawford et al 1996, Cooke and Duncan 1997, Forster et al 2000), as well as the intergeneric relationships among these oomycetes (Cooke et al 2000).
Although rDNA has been widely used in phylogenetic studies, the evolution of one gene may not represent the evolution of the entire genome, as Shen (2001) pointed out. Thus it is necessary to separately sample as many additional independent genes as possible and compare the phylogenies derived from these genes to see whether they support or contradict each other. Thus genes coding for metabolic and structural proteins such as cytochrome oxidase II and ß tubulin, respectively, are receiving increasing attention. These genes are conserved and the alignment of their sequences is less ambiguous compared to rDNA (Bruns et al 1991).
As its name implies the cytochrome oxidase II (cox II) gene codes for the enzyme that catalyzes the terminal step in the electron transport chain, the transfer of an electron from cytochrome c to oxygen. Hence, unlike the ITS region, it is mitochondrially encoded and so it is considered generally to be more variable than nuclear DNA. It has been proven useful for exploring relationships especially at the subgeneric or lower levels of various taxa. Martin (2000) analyzed 684 bp of the cox II gene in assessing the phylogenetic relationships among 24 species of Pythium. He found that the species grouped into three major clades that in a general sense were reflective of zoosporangial or hyphal swelling morphology. Three years later he and Tooley (2003) published a cox II phylogeny of Phytophthora. They reported that the phylogenetic relationships among species observed in the cox II gene trees did not exhibit consistent similarities in groupings for morphology, pathogenicity, host range or temperature optima. To date one report (Hudspeth et al 2000) examines the intergenic relationship between Pythium and Phytophthora using cox II.
Another gene that is growing in importance in phylogenetic studies is the ß-tubulin gene. It codes for one of the two conserved families of tubulins, the building blocks of microtubules which make up the cytoskeleton, mitotic spindles and flagella of eukary-otic cells. It has been found useful in reconstructing the phylogenetic relationships among fungi at all levels (Thon and Royse 1999). However no such studies have been reported so far for Pythium and Phytophthora. Thus this is the first report of a ß-tubulin-based phylogeny of these two genera. So far the complete coding sequence of the ß tubulin in two Pythium ultimum isolates and one Phytophthora cinnamomi isolate have been set forth respectively by Mu et al (1999) and Weerakoon et al (1998). It is based on these three ß-tubulin gene sequences that our primers have been designed to amplify partial sequences of this gene in the Pythium and Phytophthora isolates.
Hence 58 isolates representing 39 Pythium species and 18 isolates representing nine Phytophthora species were chosen to investigate the relationships within each genus using sequence analysis of three genomic areas, namely ITS rDNA, cox II and ß-tubulin genes. We have extended the study of Matsumoto et al (1999) by sequencing more representative Pythium and Phytophthora isolates. Also, using the same isolates used for the ITS rDNA, cox II and ß-tubulin, gene sequences were analyzed as well.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
), together with one Saprolegnia parasitica isolate that was used as outgroup in the phylogenetic analyses. Fifty ITS-5.8S rDNA and 23 cox II sequences were drawn from the worldwide DNA database.
|
DNA amplification and sequencing.— –
The nuclear rDNA region of the internal transcribed spacers (ITS), including the 5.8S rDNA, was amplified with the universal primers ITS 1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS 4 (5' TCCTCCGCTTATTGATATGC 3') as described by White et al (1990). The amplicons were 700–900 bp long. On the other hand 563 bp of the cox II gene was amplified with the primer pair FM66 (5' TAGGATTTCAAGATCCTGC 3') and FM58 (5' CCA-CAAATTTCACTACATTGA 3') for Pythium (Martin 2000) and FM75 (5' CCTTGGCAATTAGGATTTCAA-GAT 3') and FM78 (5' ACAAATTTCACTACATTGTCC 3') for Phytophthora (Martin and Tooley 2003). The primers used for the ß-tubulin gene were designed by aligning published ß-tubulin gene sequences of P. ultimum (AF218256
[GenBank]
and AF115397
[GenBank]
) (Mu et al 1999) and Ph. cinnamomi (PCU22050) (Weerakoon et al 1998) with MultAlin software (Corpet 1988). The total length of the alignment was 1650 nucleotides. Then, using the Primer Express software 2.0 (Applied Biosystems, Foster City, California), regions spanning ca 17–24 nucleotides with little or no sequence variation, 55–65 C Tm, 50–55% GC content and minimal secondary structure formation were chosen as potential primer sites. Of the several primers tested, forward primer BT5 (5' GTATCATGTGCACGTACTCGG 3') and reverse primer BT6 (5' CAAGAAAGCCTTACGACGGA 3'), which amplified 658 bp, worked best and were selected for PCR and sequencing.
Amplification of the sequencing template was carried out with DNA Thermal Cycler 2700 (Applied Biosystems) with a cycling profile of pre-PCR at 94 C for 5 min, followed by denaturation at 94 C for 1 min, 1 min primer annealing at 55 C for ITS, 52 C for cox II and 63 C for ß-tubulin and elongation at 72 C 2 min for 40 cycles, with a 7 min extension at 72 C after the final cycle. To check the presence of PCR products, 5 µL of the PCR reaction mixture was loaded in 2% L03 (Takara Bio) agarose gel, electrophoresed at 100 V 20–30 min and stained with ethidium bromide. The sequencing templates were purified with GenElute PCR Clean-up Kit (Sigma Chemical Co., St Louis, Missouri) following the manufacturer’s instructions. Sequencing was performed with BigDye Terminator v3.1 Cycle Sequencing Reaction Kit (Applied Biosystems) using the same primers in the initial PCR step, plus ITS2 (5' GCATCGATGAAGAACGCAGC 3') and ITS3 (5' GCTGCGTTCTTCATCGATGC 3') for the ITS regions. After purifying the sequencing reaction mixture through ethanol precipitation it was run on ABI 3100 DNA Sequencer (Applied Biosystems).
Sequence analysis.— –
Multiple alignment was performed with Clustal X. Then we searched for maximum parsimony trees in the unordered, unweighted nucleotide data with PAUP (Swofford 1998), using the heuristic option and random stepwise addition replicates. Bootstrap proportions (Felsenstein 1985), measuring the frequency of a branch’s occurrence in the resampling of pseudoreplicates from the dataset, were calculated with PAUP. Distance estimates were computed with MEGA2 software using the Kimura 2-parameter model (Kumar et al 2001).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
) were calculated for all pairwise combinations of isolates. Genetic distances among all ingroup taxa ranged from 0% (mostly between isolates of the same species) to 30.98% (between P. arrhenomanes and P. helicoides). Intrageneric distances among Pythium isolates were in a range of 0–32.4% (between P. periilum and P. oedochilum) while those among isolates within the genus Phytophthora were 0–11.5% (between Ph. nicotiana and Ph. megasperma). The lowest genetic distance from outgroup (Saprolegnia parasitica) was computed to be 35.9% (P. arrhenomanes and P. aristosporum) whereas the highest was 46.1% (P. helicoides).
The alignment for the phylogenetic analysis of the ITS region of the rDNA comprised 1247 characters, of which 451 characters were constant. Of the 796 variable characters, 677 (85%) were parsimony informative. The remaining 119 variable characters were uninformative and thus excluded from the parsimony analysis. The strict-consensus tree with bootstrap values is shown (FIG. 1).
|
Cox II.— – Kimura 2-parameter sequence distance measurement range was 0–14.9% substitutions (P. torulosum and P. vexans) within the genus Pythium and 0.18–7.6% substitutions (Ph. citricola and Ph. cactorum) within the genus Phytophthora. Among ingroup taxa genetic distance was greatest between P. graminicola and Ph. citricola (16.7% substitutions). Compared with Saprolegnia parasitica, P. zingiberum had the highest genetic distance of 25.1% substitutions while Ph. sojae was the lowest (20% substitutions).
Unlike in the ITS region, gaps were not observed in the 563 bp cox II sequence alignments. Of the 249 variable characters in the alignment of the cox II gene 180 (72.3%) parsimony informative characters were used for the phylogenetic analyses. The remaining 69 uninformative characters were excluded for the parsimony analysis. The strict consensus tree is shown (FIG. 3). Bootstrap supports of more than 50% are indicated.
|
ß tubulin.— – Among the ingroup taxa P. middletonii and a Group G Pythium isolate exhibited the highest genetic distance (19.8%). Pythium intrageneric genetic distance was 0–20.4% (between P. rostratum and P. zingiberum) while that of Phytophthora was 0–9% (between Ph. vignae and Ph. capsici). The highest and the lowest genetic distances relative to Saprolegnia parasitica was obtained respectively from Ph. capsici (17.4%) and P. orthogonon (12%).
Among the three genes studied here the ß-tubulin data had the lowest consistency (CI = 0.2922) and retention indices (RI = 0.7549) indicating considerable homoplasy in this character. In contrast the highest CI (0.4614) and RI (0.8337) were obtained from the ITS region data.
Like the cox II gene there were no gaps in the alignment of the 658 bp of the partial ß-tubulin gene sequence. A total of 224 variable characters were found, and of these 203 were parsimony informative and included in the phylogenetic analyses. The strict consensus tree with the bootstrap values on its nodes is provided (FIG. 3
).
ß-tubulin phylogenetic analysis divided the isolates into three major clades that were different somewhat from those in the ITS and cox II gene trees. Clade 1 consists of 26 isolates representing 15 Pythium species which are also members of Clade 1 for both ITS and cox II. However P. periplocum, P. oligandrum and P. hydnosporum moved out of Clade 1 but still clustered together in a minor group that has a 100% bootstrap support. Furthermore two former Clade 1 members, P. myriotylum (isolate GF46) and P. arrhenomanes (isolate ATCC 96525), were found unexpectedly in a different clade, together with P. irregulare and other ITS and cox II Clade 2 members. Moreover Clade 2 groups the Phytophthora isolates altogether in one subclade (94% bootstrap value). Two more highly supported subclades in Clade 2 were apparent. One contains P. orthogonon, P. vexans, P. nodosum, P. nunn and P. rostratum, all of which bear subglobose proliferating sporangia. The other subclade has the two P. helicoides isolates. Clade 3, which is equivalent to Clade 2 in the ITS and cox II trees, comprises Pythium isolates with spherical sporangia, together with isolates that belong to Clade 4 in the ITS and cox II trees, namely P. oedochilum and P. vexans.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). However other workers suggested that it should be the size of the reproductive structure (Waterhouse 1963), oogonial ornamentation (van der Plaats-Niterink 1981) or oogonial characteristic (Dick 1990) among others. However evidences from molecular studies that support Middleton’s theory have begun to accumulate in recent years. Briard et al (1995) presented preliminary results correlating molecular clusters with subgroups defined on sporangial form. The two main branches in their 28S RNA dendrogram respectively showed groupings with species having spherical sporangia (e.g. P. ultimum, P. sylvaticum and P. irregulare) and species having filamentous sporangia (e.g. P. sulcatum and P. aphanidermatum). They even found 11 bases characteristic of this separation. Also the ITS and 5.8S rDNA sequence analysis by Matsumoto et al (1999) divided 30 Pythium species into two groups that corresponded with sporangial morphology, namely the "F group" (filamentous to lobulate sporangia) and the "S group" (spherical sporangia). The same manner of grouping was evident in the phylogenies by Lévesque and de Cock (2004) according to the ITS region and D1, D2 and D3 regions in the large subunit nuclear rDNA and Martin (2000) based on cox II gene sequence.
In addition these two studies also paid attention to some species that they claimed to occupy an intermediate position between the two groups based on sporangial morphology. One such is P. oligandrum, a species that produces contiguous sporangia (i.e. subglobose zoosporangia with interconnecting filamentous parts), according to Martin (2000). Based on our cox II gene sequence it was found to be intermediate between Clade 3 (species with subglobose to filamentous to lobate zoosporangia) and the two other clades (1 and 2), which contained species that produce spherical to globose zoosporangia. In our study P. oligandrum formed a small group (100% bootstrap support) with P. periplocum and P. hydnosporum in all three gene trees. Of note in the study by Lévesque and de Cock (2004) these three species, along with other species bearing contiguous sporangia, also belonged to the same small clade (D) which was found between two major clades. This was also the case in our ITS tree. However in our cox II tree it was a sister group of the other subclades in Clade 1 while in the ß-tubulin tree it did not group with any of the three major clades.
Consistent among the three DNA regions, isolates of morphologically similar species grouped together. For instance a particularly strong node combined P. myriotylum and P. zingiberum, as also observed by Matsumoto et al (1999) and Lévesque and de Cock (2004). So did the Group F isolate (MuShi) and P. dissotocum (both having noninflated filamentous sporangia), P. mamillatum and P. spinosum (both having spiny oogonia), P. orthogonon, P. nunn and P. vexans. The same also was true for P. aphanidermatum and P. deliense, as also reported by studies using SDS-PAGE of soluble proteins and starch gel isozyme analysis (Chenet et al 1991), serological profiling (White et al 1994) and ITS region sequence analysis (Lévesque and de Cock 2004). Although they are similar in temperature growth relations, pathogenicity, host range and morphology, according to Chen et al (1991), they still were considered distinct species based on minor differences in the arrangement of the oogonium and antheridium, mean oospore diameter and sporangial complexity (van der Plaats-Niterink 1981).
Likewise in this study P. oligandrum always clustered with P. periplocum and P. hydnosporum (100% bootstrap support in all trees). Such close relationship is illustrated in at least one documented case wherein a P. oligandrum isolate from wilting poppies in South Africa was misidentified as P. hydnosporum due to their similar microscopic morphology, as Godfrey et al (2003) recounted. Of note "black compost" disease was implicated on P. oligandrum in the UK while in the US it is caused by P. hydnosporum. Thus Godfrey et al (2003) noted that it is yet to be resolved whether these two species indeed are different species producing the same disease symptoms or they are in fact conspecific. The result of our study supports the first hypothesis. Sequence analysis of the ITS rDNA region, cox II and ß-tubulin genes clearly resolved and differentiated these two species. Actually in the ß-tubulin and the ITS rDNA trees P. oligandrum showed more sequence similarity with P. periplocum than with P. hydnosporum. P. periplocum is considered to be a morphologically unique species because it is the only known Pythium species with both ornamented oogonia and filamentous inflated sporangia (van der Plaats-Niterink 1981).
In addition the four P. arrhenomanes isolates always grouped together with the two P. aristosporum isolates in all three gene trees. Van der Plaats-Niterink (1981) noted that they indeed are closely related morphologically and differ only by the number of antheridia (up to eight or more in P. aristosporum, up to 20 or more in P. arrhenomanes). In relation to this P. arrhenomanes was thought to be considered to be most closely related to P. graminicola. As a matter of fact, based on their total protein electrophoresis and isozyme analysis, Chen et al (1991) suggested that these two were not distinct species and must be combined. However Chen and Hoy (1993) proved otherwise after morphologically studying a worldwide collection of these two species and by examining variation in PCR-amplified rDNAs. The present sequence analysis of three different DNA regions agreed with the findings of the latter study. The three phylogenetic trees show that P. arrhenomanes is more closely related to P. aristosporum and even to P. volutum, compared to P. graminicola.
Furthermore, in Martin’s cox II dendrogram (2000), P. torulosum clustered with P. catenulatum, a grouping that reflected some similarity in sporangial morphology but did not reflect precise differences because sporangia of P. torulosum consist of inflated branched toruloid outgrowths of the mycelia while those of P. catenulatum consist of irregularly swollen branched parts of the mycelium (van der Plaats-Niterink 1981). This same grouping plus P. pyrilobum was observed in our three gene trees in 99–100% of all bootstrap replicates. P. pyrilobum produces compound sporangia that consists of globose, pyriform and filamentous elements with occasionally irregularly inflated parts.
Five P. irregulare isolates, each representing the four DNA groups by Matsumoto et al (2000) also were included in this study. Like their results, the DNA group I (MAFF 305572 and EP-2) and II (74–22) isolates are more closely related to each other than to the DNA group III (K6-2) and IV (Py61), based on the three DNA regions in our study.
Phylogenetic relationships among Phytophthora species.— –
In the present study using three independent DNA regions, 18 Phytophthora isolates representing five of the six morphological groups by Waterhouse (1963) appeared in a common clade, except for Ph. undulata which had been considered a Pythium species (P. undulatum) until its reclassification by Dick (1989) on the basis of zoospore differentiation and rDNA analysis. This species remains a taxonomically difficult species, as will be discussed in the next section. Nonetheless the merging of the regular Phytophthora species received high bootstrap support in the ITS tree (100%) and ß-tubulin tree (95%) but a fairly weak bootstrap support in the cox II tree (65%).
More important the classical morphological grouping based on sporangial papillation agreed to some degree with the grouping according to the sequences of the three genes. This is most visible in the ITS gene tree wherein the Phytophthora clade branched into three distinct subclades. The first is composed of nonpapillate Phytophthora spp. (Ph. sojae, Ph. vignae. Ph. cinnamomi and Ph. megasperma). The second is occupied mostly by semipapillate specimens (all three Ph. citricola isolates). One Ph sojae isolate (IFO 31016), which is suspected to be a misidentified Ph. citricola isolate (pers comm), and one Ph. capsici isolate, which bears papillate sporangia, also belong to this branch. The other papillate isolates, namely Ph. nicotiana and the four Ph. cactorum isolates are found in the third branch. These results are in accordance with those of Cooke and Duncan (1997), Crawford et al (1996), Forster et al (2000), Briard et al (1995) and Martin and Tooley (2003).
Another interesting argument about the phylogeny of the Phytophthora is that within this genus there has been an evolutionary advance from the soilborne, nonpapillate species to the papillate and largely airborne species which shows the closest affinity to the downy mildews (Gäumann and Wynd 1952). This is plainly reflected in the ß-tubulin gene tree in which nonpapillate isolates were found to be basal to the papillate and semipapillate isolates. This still needs to be validated however.
Among the three gene trees cox II is the least informative with regard to species morphological groupings. That is nonpapillate isolates were not lumped in a single subclade (neither were papillate and semipapillate ones). Genetic divergence within the Phytophthora clade of the cox II gene tree was higher compared to those of the other two gene trees. This indicates that, being a mitochondrial gene, cox II was the most variable among the three DNA regions studied here. It is known that there are more frequent mutations in mitochondrial genes compared to nuclear genes because the mitochondrion lacks many of the DNA repair systems that operate on nuclear genes (Brown 2002). Such variability may be used in designing species-specific primers that will be of great help in the detection and diagnosis of diseases caused by Phytophthora.
It is also noteworthy to enumerate two important trends that not only are consistent among the three DNA regions studied here but also with previous studies using other techniques. First there are certain Phytophthora species that consistently paired together in all three gene trees, thereby signifying their affinity. Among these are Ph. sojae and Ph. vignae (which is contrary to the findings of Crawford et al 1996 because Ph. vignae was more similar to Ph. cinnamomi according to ITS I and II regions) and Ph. cactorum and Ph. nicotiana (in corroboration with DNA RFLP data analysis by Forster and Coffey [1993]). Second diversity among the three Ph. megasperma isolates also was apparent in all three gene trees. They are found either clustered with other nonpapillate species or separately unaffiliated with other subclades within the Phytophthora clade. It is also interesting to note its intermediate position between the papillate and non-papillate groups in the ITS tree, as also suggested by Cooke and Duncan (1997). However this was not seen in the cox II tree and the ß-tubulin tree. In the latter it occupied a basal position relative to the other groups.
This study provides additional evidence that other morphological characteristics such as antheridial attachment and homo- and heterothallism, as well as physiological diversity in host range, are not indicative of close phylogenetic relationships because these characters are found in scattered positions in all three phylogenetic trees. Cooke et al (1999), Cooke and Duncan (1997) and Forster et al (2000) attributed this to the possibility that these characters are homoplasies having evolved several times independently. Thus it may be inferred that they are under simple genetic control.
Phylogenetic relationship between Pythium and Phytophthora.— –
As stated by Brasier and Hansen (1992), within the peronosporalean line, similarities within the genera Pythium and Phytophthora are widely acknowledged and hence they are classified in the same family (Pythiaceae). Both produce oospores and nonseptate coenocytic mycelia. Both have diploid vegetative cells, and meiosis occurs in the oogonia and antheridia before oospore formation. Nevertheless they can be distinguished from each other most distinctively by the formation of zoospores within the sporangium of Phytophthora (in Pythium zoospores form after the protoplasm has flowed from the sporangium into a vesicle). Other distinguishing morphological and physiological characters are sporangium position, sporangium caducity, mycelium thickness, oogonia wall pigmentation, thiamine requirement and inhibition by hymexazol in the isolation medium.
However the phylogenetic relationship between these two genera is yet to be established. It long has been perceived that Pythium is ancestral to Phytophthora because of its less specialized parasitism and its more primitive sporangial development (Tucker 1931, Gaumann and Wynd 1952). In fact Gaumann and Wynd (1952) proposed an evolutionary advance from soilborne, unspecialized Pythium species through the Phytophthora to the downy mildews adapted to an aerial environment. This hypothesis was tested for the first time with molecular evidence by Cooke et al (2000). Their ITS-based phylogeny supported the evolution of Phytophthora via a Pythium-like ancestor whose nature is still unclear. Briard et al (1995) and the present study also reached the same conclusion as indicated by the higher genetic divergence within Pythium than within Phytophthora. Moreover Phytophthora proved to be a monophyletic group whereas Pythium is a polyphyletic one, suggesting that Phytophthora is a relatively recently evolved genus having not yet radiated into many forms as compared to Pythium.
Consequently, in the search for the missing link or the intermediate species between Pythium and Phytophthora, some particular species have warranted attention because they seem to provide evidence of intergeneric relatedness. One is Phytophthora undulata, which first was described as Pythium undulatum (Petersen 1909), then transferred to Pythiomorpha, a synonym of Phytophthora (Apinis 1929), and renamed as Phytophthora undulata (Dick 1989). However this classification has been challenged consistently because molecular evidence indicated that it is more closely related to Pythium species (Cooke et al 2000). In the present study the position of Ph. undulata varied in the three gene trees. Whereas it was unaffiliated with any of the three major clades in the cox II and ß-tubulin trees, in the ITS tree it was basal to Clade 1, which contains filamentous Pythium isolates, corroborating with the results of Cooke et al (2000). However it still is too early to draw conclusions as to the intermediate species position of this species.
However our endorsement of the above taxa as the Pythium-to-Phytophthora transition species still needs validation. The present study made use of a limited number of Phytophthora species as restricted by the unavailability of other isolates. But to circumvent this limitation we ensured the use of isolates that will represent the morphological groups according to the Waterhouse classification. But further studies involving more Phytophthora species are recommended to validate our claim.
|
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Corresponding author: kageyama{at}green.gifu-u.ac.jp
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Briard M, Dutertre M, Rouxel F, Brygoo Y. 1995. Ribosomal RNA sequence divergence within the Pythiaceae. Mycol Res 99:1119–27.
Brown TA. 2002. Genomes. UK: Bios. 496 p.
Bruns TD, White TJ, Taylor JW. 1991. Fungal molecular systematics. Ann Rev Ecol System 22:525–564.[CrossRef]
Chen W, Hoy JW. 1993. Molecular and morphological comparison of Pythium arrhenomanes and P. graminicola. Mycol Res 97:1371–1378.
———, Schneider RW. 1991. Comparisons of soluble proteins and isozymes of seven Pythium species and applications of the biochemical data to Pythium systematics. Mycol Res 95:548–555.
Cooke DEL, Duncan JM. 1997. Phylogenetic analysis of Phytophthora species based on ITS1 and ITS2 sequences of the ribosomal RNA repeat. Mycol Res 101:667–677.[CrossRef]
———, Drenth A, Duncan JM, Wagels G, Brasier CM. 2000. A molecular phylogeny of Phytophthora and related oomycetes. Fun Gen Biol 30:17–32.
Corpet F. 1988. Multiple sequence alignment with hierarchal clustering. Nucleic Acid Res 16:10881–10891.
Crawford AR, Bassa BJ, Drenth A, Maclean DJ, Irwin JAG. 1996. Evolutionary relationships among Phytophthora species deduced from rDNA sequence analysis. Mycol Res 100:437–443.
Dick MW. 1989. Phytophthora undulate Comb. Nov. Mycotaxon 35(2):449–453.
———. 1990. Keys to Pythium. Reading, UK: University of Reading, School of Plant Science, Department of Botany. 64 p.
———. 1995a. Sexual reproduction in the Peronosporomycetes (chromista fungi). Can J Bot 73:5712–5724.
———. 1995b. The straminipilous fungi: a new classification for the biflagellate fungi and their uniflagellate relatives with particular reference to lagenidiaceous fungi. CAB International Mycological Paper 168.
Erwin DC, Ribeiro OK. 1996. Phytophthora diseases worldwide. St. Paul, Minnesota: American Phytopathological Society Press. 562 p.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791.[CrossRef]
Forster H, Coffey MD. 1993. Molecular taxonomy of Phytophthora megasperma based on mitochondrial and nuclear DNA polymorphisms. Mycol Res 97:1101–1112.
———, Cummings MP, Coffey MD. 2000. Phylogenetic relationships of Phytophthora species based on ribosomal ITS I DNA sequence analysis with emphasis on Waterhouse groups V and VI. Mycol Res 104:1055–1061.[CrossRef]
Gaumann EA, Wynd FL. 1952. The Fungi. New York: Hafner Publishing Co.
Godfrey SAC, Monds RD, Lash DT, Marshall JW. 2003. Identification of Pythium oligandrum using species-specific ITS rDNA PCR oligonucleotides. Mycol Res 107:790–796.[CrossRef][Medline]
Gunderson JH, Elwood H, Ingold A, Kindle K, Sogin ML. 1987. Phylogenetic relationships between chlorophytes, chrysophytes, and oomycetes. Proc Natl Acad Sci USA 84:5823–5827.
Hudspeth DSS, Nadler SA, Hudspeth MES. 2000. A cox2 molecular phylogeny of the Perosoporomycetes. Mycologia 92:674–684.[CrossRef]
Kimura M. 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16:111–120.[CrossRef][Medline]
Kumar S, Tamura K, Jakobsen IB, Nei M. 2001. MEGA2: molecular evolutionary genetics analysis software. Tempe, Arizona: Arizona State University.
Kurachek T, Mitchell D. 2000. Diseases of agronomic and vegetable crops caused by Pythium. Florida Plant Pathology Fact Sheet, 53 p.
Lee SB, Taylor JW. 1992. Phylogeny of five fungus-like protoctistan Phytophthora species, inferred from the internal transcribed spacers of ribosomal DNA. Mol Biol Evol 9:636–653.[Abstract]
Lévesque CA, de Cock AW. 2004. Molecular phylogeny and taxonomy of the genus Pythium. Mycol Res 108: 1363–1383.[CrossRef][Medline]
Martin FN, Tooley PW. 2003. Phylogenetic relationships among Phytophthora species inferred from sequence analysis of the mitochondrially encoded cytochrome oxidase I and II genes. Mycologia 95(2): 269–284.
———. 2000. Phylogenetic relationships of some Pythium species inferred from sequence analysis of the mitochondrially encoded cytochrome oxidase I and II genes. Mycologia 92:711–727.[CrossRef]
Matsumoto C, Kageyama K, Suga H, Hyakumachi M. 1999. Intraspecific DNA polymorphisms of Pythium irregulare. Mycol Res 104:1333–1341.[CrossRef]
———, ———, ———, ———. 2000. Phylogenetic relationships of Pythium species based on ITS and 5.8S sequences of the ribosomal DNA. Mycoscience 40:321–331.[CrossRef]
Middleton J. 1943. The taxonomy, host range and geographic distribution of the genus Pythium. Memoirs of the Torrey Botanical Club 20:1–171.
Mu JH, Bollon AP, Sidhu RS. 1999. Analysis of beta-tubulin cDNAs from taxol-resistant Pestalotiopsis microspore and taxol-sensitive Pythium ultimum and comparison of taxol-binding properties of their products. Mol Gen Genet 262(4–5):857–868.[CrossRef][Medline]
Panabieres F, Marais A, Trentin F, Bonnet P, Ricci P. 1989. Repetitive DNA polymorphism analysis as a tool for identifying Phytophthora species. Phytopathology 79:1105–1109.[CrossRef]
Petersen HE. 1909. Studier over Ferskvands-Phycomyceter. Bot Tidsskrift 29:345–440.
Shen QS. 2001. Molecular phylogenetic analysis of Grifola frondosa (Maitake) and related species and the influence of selected nutrient supplements on mushroom yield [Doctoral dissertation]. The Pennsylvania State University Graduate School. 141 p.
Stamps DJ, Waterhouse GM, Newhook FJ, Hall GS. 1990. Revised tabular key to the species Phytophthora. 2nd ed. Mycological Papers 162. Oxfordshire, England: CAB International Mycological Institute.
Thon MR, Royse DJ. 1999. Partial ß-tubulin gene sequences for evolutionary studies in the Basidiomycotina. Mycologia 91:468–474.[CrossRef]
Tucker CM. 1931. Taxonomy of the genus Phytophthora de Bary. Missouri Agricultural Experimental Station Research Bulletin 153:208.
van der Plaats-Niterink AJ. 1981. Monograph of the genus Pythium. Studies in Mycology 21. Baarn, Netherlands: Centraalbureau Voor Schimmelcultures.
Waterhouse GM. 1963. Key to the species of Phytophthora de Bary. Mycological Papers 92:1–22.
Weerakoon ND, Roberts JK, Lehnen LP, Wilkinson JM, Marshall JS, Hardham AR. 1998. Isolation and characterization of the single beta-tubulin gene in Phytophthora cinnamomi. Mycologia 90:85–95.[CrossRef]
White JG, Lyons NF, Wakeham AJ, Mead A, Green JR. 1994. Serological profiling of the fungal genus Pythium. Physiol Mol Plant Path 44:349–361.[CrossRef]
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR Protocols: a guide to methods and applications. San Diego: Academic Press. p 315–322.
This article has been cited by other articles:
 |
|
 |
|
  E. Moralejo, A. Clemente, E. Descals, L. Belbahri, G. Calmin, F. Lefort, C. F.J. Spies, and A. McLeod Pythium recalcitrans sp. nov. revealed by multigene phylogenetic analysis Mycologia, March 1, 2008; 100(2): 310 - 319. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
