| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Plant Pathology, Washington State University, Tree Fruit Research and Extension Center, 1100 North Western Avenue, Wenatchee, Washington 98801
J.D. Rogers
Department of Plant Pathology, Washington State University, Pullman, Washington 99164-6430
Y.K. Kim
Q. Liu
Department of Plant Pathology, Washington State University, Tree Fruit Research and Extension Center, 1100 North Western Avenue, Wenatchee, Washington 98801
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSTAXONOMYRESULTSDISCUSSIONLITERATURE CITED |
|---|
A new species of Phacidiopycnis associated with pome fruits is described. The fungus causes fruit rot on apples during storage and is associated with a twig dieback and canker disease of crabapple trees and dead twigs of pear trees. To characterize the biology of the fungus and compare it with Ph. piri, the type species of the genus, effects of nine media and light on mycelial growth and pycnidial production, mycelial growth in response to temperature and mode of conidial germination in response to nutrient were determined. Apple-juice agar, pear-juice agar, prune-juice agar, potato-dextrose agar (PDA) and malt-extract agar, Czapek-Dox agar and oatmeal agar (OMA) favored mycelial growth. Cornmeal agar (CMA) did not favor mycelial growth. Light effect on pycnidial formation was medium dependent. Abundant pycnidia with mature conidia formed in 14 d old PDA and OMA cultures at 20 C, regardless of light, whereas none or very few pycnidia formed on other media in the dark. Fluorescent light stimulated formation of pycnidia except on CMA. The fungus grew at –3–25 C, with optimum growth at 15–20 C. Conidia germinated either by forming germ tubes or less often by budding. Budding of conidia occurred in 1 and 10% pear-juice solutions but not in 100% pear-juice solution. Six isolates of Ph. washingtonensis from different species of pome fruits had identical ITS sequences. The sizes of the ITS region were the same for both Ph. washingtonensis and Ph. piri, and four polymorphic nucleotide sites were found in the ITS region between Ph. washingtonensis and Ph. piri. The similarity in ITS sequences between these two taxa is confirmatory evidence for the erection of the new species of Phacidiopycnis associated with pome fruits we describe here.
Key words: Caulicolous fungi, Malus, Phacidiaceae, postharvest fruit-rotting fungi, Potebniamyces, Pyrus
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSTAXONOMYRESULTSDISCUSSIONLITERATURE CITED |
|---|
). In a separate investigation conducted to determine the causal agent(s) of a canker and dieback disease of crabapple trees in commercial apple orchards, the same fungus was isolated from margins between healthy and diseased tissues of twigs with dieback. Pycnidia of the fungus also were observed on cankers or diseased twigs of crabapple trees (FIG. 4); cultures derived from all three were similar, and we suspected that they were all representatives of the same species. In this paper we describe a new species of Phacidiopycnis, based on the morphological and cultural characteristics and sequencing of the internal transcribed spacer (ITS) region of rDNA, and compare the new species with the type Phacidiopycnis piri (Fuckel) Weindlm.
|
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSTAXONOMYRESULTSDISCUSSIONLITERATURE CITED |
|---|
Isolates used for culture studies and ITS sequencing.— –
Isolates are listed (TABLE I). Four isolates of Potebniamyces pyri (Berk. & Broome) Dennis (
Phacidiopycnis piri) from d’Anjou pear in the Pacific Northwest and two from CBS were included for comparison by molecular analysis. Isolate CLX745 was derived from a single ascospore from an apothecium of Potebniamyces pyri on dead bark from a d’Anjou tree in a pear orchard in Peshastin, Washington. The voucher specimen from which this isolate was derived is deposited at WSP (WSP 70479). Herbarium designations follow Holmgren et al (1990). Living cultures of both P. pyri and Ph. washingtonensis are deposited with ATCC (TABLE I).
|
). All measurements were based on 25 observations. Descriptive statistical analysis of the measurements was obtained using Excel 2002 (Microsoft). Colors are according to Rayner (1970).
To characterize the biology of Ph. washingtonensis and compare it with Ph. piri, mycelial growth and colony morphology were evaluated on nine media (TABLE 2), which have been used to characterize Ph. piri (Xiao and Sitton 2004). Petri plates, each containing one of the nine test media, were inoculated with 4 mm diam mycelium plugs. There were five replicate plates of each medium for each isolate. The cultures were incubated at 20 C in the dark. The colony diameter in each plate was measured at 3 and 5 d after inoculation and the colony morphology was noted.
|
). Plates were inoculated as described previously. All plates were sealed with Parafilm (Pechiney Plastic Packaging, Chicago, Illinois) and incubated at 20 C either in the dark or under 12 h alternating cycles of dark and fluorescent light (5 W m–2) in an environment-controlled chamber. There were three replicate plates for each combination of medium and light regime. Pycnidia development was visually evaluated weekly for 2 wk. Five pycnidia were selected, both at the edge of colony and in the middle of colony radius, from each plate to confirm whether conidia were present within each pycnidium. Mycelial growth of CLX2152, CLX2520 and CLX2528 in response to temperature ranges of –3–35 C was evaluated on PDA. There were five replicate plates for each isolate at each temperature. Colony diameters of cultures were measured after 12 and 18 d of incubation at –3 and 0 C, 6 and 12 d of incubation at 5 C, 3 and 6 d of incubation at 10, 15, 20 C, and 3, 6, and 10 d of incubation at 25, 30 and 35 C. Cultures that did not grow after 10 d at 30 and 35 C were moved to 20 C, and colony diameters were measured after 4 d at 20 C to determine whether the fungus would resume growth. Daily radial growth was calculated for each temperature treatment at each measurement time, and the data from the two measurement times were averaged for each temperature.
Conidial germination.— – Two isolates (CLX 2152 and CLX 2528) were used in this study. Germination was evaluated in deionized water, 1, 10 and 100% pear-juice solutions. Each plate of 2 wk old PDA cultures growing at 20 C in the dark that had pycnidia discharging conidia drops was flooded with 20 mL of a designated solution to make conidial suspensions, which then were filtered through four layers of cheesecloth. Concentrations of conidial suspensions were adjusted to 2 x 105 conidia per mL, and 10 µL of the conidial suspension was delivered by a pipette onto each cover slip. Three cover slips were placed on moist filter paper in a plastic Petri plate. Plates were wrapped with Parafilm, placed in plastic boxes and incubated at 20 C in the dark. Three cover slips were removed from each temperature after 10, 12, 14, 16, 18, 20, 22, 24 and 36 h of incubation, respectively. Percentage of germination was determined by examining 100 conidia per cover slip under a microscope. A conidium was considered to have germinated if the germ tube was at least one-half the length of the conidium or budding of the conidium was evident. The mode of germination of each germinated conidium was noted.
In a separate experiment conidia from 2 wk old PDA cultures of isolates CLX2152, CLX2521 and CLX 2527 were streaked on water agar (WA), 1% pear-juice agar, 20% pear-juice agar and PDA. Plates were incubated at 20 C in the dark. Germination of conidia was examined at 12, 24, 36 and 48 h after inoculation.
Production of mycelium and DNA extraction.— –
Isolates were grown in potato-dextrose broth (Difco Laboratories, Franklin Lakes, New Jersey) in 60 mm diam Petri plates, each containing 10 mL of the medium. Cultures were incubated 10 d at 20 C in the dark. Mycelium was harvested by removing mycelial mats from the surface of the medium. Mycelium was lyophilized and ground to a fine powder in a mortar and pestle. DNA was extracted according to the method of Lee and Taylor (1990) with modification of the lysis buffer in which 100 mM Tris (pH 8.0) was used instead of 50 mM Tris (pH 7.2) and without the addition of 2-mercaptoethanol. RNA was digested with 10 mg/µL RNAse (Promega, Madison, Wisconsin) at 37 C for 2 h, and DNA samples were quantified in 1% agarose gels with known concentrations of lambda DNA (Promega, Madison, Wisconsin). Concentrations of all DNA samples were diluted to 5–10 ng/µL before use in PCR amplifications.
PCR amplification, ITS sequencing and sequence analysis.— –
The nuclear ribosomal internal transcribed spacer region (ITS rDNA, including ITS1, 5.8S and ITS2 regions) was amplified using the primers ITS1 (5'TCCGTAGGTGAACCTGCGG3') and ITS4 (5'TCCTCCGCTTATTGATATGC3') (White et al 1990). PCR was conducted in a final reaction volume of 25 µL containing 1x PCR buffer (New England Biolabs Inc., Beverly, Maryland), 1 unit Taq DNA polymerase (New England Biolabs Inc., Beverly, Maryland), 2 mM MgCl2 (Promega, Madison, Wisconsin), 0.2 mM dNTPs (MBI Fermentas, Amherst, New York), 0.4 µM of each primer (Qiagen, Alameda, California) and 5–10 ng fungal DNA. Reactions were carried out in a Hybaid Omn-E thermocycler (Hybaid, Middlesex, UK), and cycling conditions consisted of this program: 1 cycle at 95 C for 1 min; 35 cycles at 95 C for 30 s, 60 C for 30 s, 72 C for 1.5 min; and 1 cycle at 72 C for 5 min. Amplicons were visualized under UV light in 1% agarose gels after staining with 0.5 µg/mL ethidium bromide. PCR products were purified before sequencing with QIAquick® PCR purification columns (Qiagen, Valencia, California) and sequenced on both strands with each sequence reaction containing 40–90 ng DNA, 320 nM primer, 4 µL BigDye Terminator Cycle Sequencing Ready Reaction Mix (Applied Biosystems, Foster City, California) and sterile distilled water in 10 µL total volumes. Cycle sequence reactions were performed in a Hybaid Omn-E thermal cycler, and cycling conditions consisted of 25 cycles of 15 s at 96 C, 15 s at 50 C and 4 min at 60 C. Products were purified using Centriflex Gel Filtration Cartridges (Edge BioSystems, Gaithersburg, Maryland), dried in a rotary evaporator and sequenced on a PE Biosystems Model 3100 Automated DNA Sequencer (Applera Corporation, Norwalk, Connecticut). All sequencing was performed in the Laboratory for Biotechnology and Bioanalysis, School of Molecular Biosciences, Washington State University. To identify related sequences from GenBank, a similarity search using the BLAST function in the database was performed with sequences of our isolates as the query sequence. Sequences were aligned using Clustal X version 1.83 (Thompson et al 1997). Sequences have been deposited in GenBank with accession numbers AY606256
[GenBank]
and AY608638–AY608648 (TABLE I
).
|
TAXONOMY |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSTAXONOMYRESULTSDISCUSSIONLITERATURE CITED |
|---|
–21
|
Pycnidia on apple fruit partly immersed or nearly free, subglobose to more or less flattened (FIGS. 1, 2, and 8), uniloculate to multiloculate (FIG. 7), up to 0.5 mm diam; ostioles or irregular apertures single or several (FIG. 8). Conidiophores multicellular lining the pycnidial cavity, producing conidiogenous cells. Conidiogenous cells integrated or discrete, lageniform to irregular with conidiogenous loci single to several (FIGS. 9–13), 5–6(–13.5) µm long x 2–3 µm broad. Conidia apparently produced enteroblastically and probably holoblastically. Conidia hyaline, lacriform with the dehiscence end flattened or ovoid to ellipsoid without the cicatrice (FIG. 14), smooth, (4.5–)6–7.5(–9) x 2–4(–5) µm (average 25 = 7 x 3.5 µm; SD = 1.5 x 0.8) in Malus domestica; (5–)6–7.5(–8) x 3–4(–4.5) µm (average 25 = 7 x 3.5 µm; SD = 0.8 x 0.5) on agar medium; (4.5–)6–7(–7.5) x 2–4 µm (average 25 = 6 x 3 µm; SD = 0.7 x 0.5) in Malus sylvestris.
Culture. –
Colonies on PDA incubated in darkness covering 9 cm diam Petri plate in 10 d, producing alternating rings of Pale Olivaceous Gray (120) and Mouse Gray (118) that are particularly evident on the reverse, appressed to lanose, with pycnidial production beginning in 5 d at plate center, with mature pycnidia discharging conidial drops in 7 d (FIGS. 5, 6). Pycnidia throughout the plate in 2 wk.
Conidia incubated in pear juice germinate by producing one (FIG. 21) or more germ tubes, by budding holoblastically to produce conidia on more or less conspicuous projections (FIGS. 17–20) or by both germ tube and buds (FIG. 16). Hyphae that develop from germinated conidia usually produce conidia by holoblastic budding under low-nutrient conditions (FIG. 15).
Conidiogenesis in pycnidia appears to be phialidic (FIGS. 9, 10, 13) and probably also holoblastic (FIGS. 11 and 12), as indicated by one or more apparent geniculations on the apices of conidiogenous cells (FIG. 11). To determine the mechanics of conidiogenesis more precisely it would require electron microscopy. Conidiogenous cells are discrete (FIGS. 10–12) or integrated (FIGS. 12 and 13).
Pycnidia are stromatic and develop by the formation of one or more convoluted locules in an initially undifferentiated stroma. Irregular openings form in the pycnidia (FIG. 8) and herein are called ostioles. The mechanics of their formation was not investigated.
Specimens examined. – UNITED STATES, WASHINGTON STATE: Chelan, Chelan County, 47°84'N, 120°02'W, on a decayed fruit of ‘Red Delicious’ apple (Malus x domestica), 21 Jul 2003, C.L. Xiao 2152 (HOLOTYPE: WSP 71071, a piece of dried apple bearing pycnidia and a dried culture initiated from an ex-type culture is included with the holotype); ATCC MYA-3320 has been deposited as an authentic ex-type culture; Manson, Chelan County, 47°81'N, 120°08'W, on a diseased twig of ‘Manchurian’ crabapple tree (Malus sylvestris), 12 Sep 2003, C.L. Xiao 2520 (WSP 71072); Manson, Chelan County, 47°81'N, 120°08'W, on a diseased twig of ‘Manchurian’ crabapple tree (Malus sylvestris), 12 Sep 2003, C.L. Xiao 2521 (WSP 71073; living culture ATCC MYA-3321).
Etymology. – From Washington State, where all specimens of Phacidiopycnis washingtonensis have been found.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSTAXONOMYRESULTSDISCUSSIONLITERATURE CITED |
|---|
). Colonies on PDA at 20 C in the dark were light gray to gray with fluffy aerial mycelium. Alternating rings of dark gray and light gray were evident in 2 wk old PDA cultures at 20 C in the dark, particularly on the reverse of the plate. The fungus grew readily on CDA. Colonies on CDA at 20 C in the dark were initially colorless to white with aerial mycelium in the central part of the colonies, later turned gray starting from the center. On 2% malt-extract agar at 20 C in the dark, colonies were colorless to white, with no or some aerial mycelium. Fruit juice-based media (AJA, PJA and PruneJA) also favored mycelial growth of the fungus, and the fungus formed circular, white to gray colonies on these media, with fluffy aerial mycelium. CMA did not favor mycelial growth.
Fluorescent light reduced mycelial growth on PDA but not on other media (data not shown). Colonies of isolate CLX2152 in 7 d old PDA cultures at 20 C were reduced from 70 mm in the dark to 49 mm under 12 h dark/12 h light. The effect of light on pycnidial production also was medium-dependent (TABLE II). Pycnidia formation, starting in the center of the plate, was evident in 5 d old PDA cultures at 20 C in the dark; pycnidia produced abundant mature conidia in 7 d old PDA cultures at 20 C in the dark; cream-colored oozing of conidia from pycnidia was commonly present. Fluorescent light significantly stimulated formation of pycnidia on the media tested except CMA. Pycnidia, if present on the media tested, produced abundant conidia in 14 d old cultures incubated at 20 C under 12 h alternating dark and light.
Temperature effect on growth.— –
The fungus was able to grow at temperatures from –3 to 25 C (FIG. 22). Radial growth rate increased with temperature up to 15 or 20 C, and then decreased rapidly as temperature increased. The fungus produced regular growth and formed circular colonies at –3 and 0 C, as at other temperatures. The average radial growth was 0.15 and 0.53 mm d–1 at –3 and 0 C, respectively. Optimal radial growth occurred between 15 and 20 C. The average radial growth was 4.16 and 4.36 mm d–1 at 15 and 20 C, respectively. At 30 C, mycelial growth of the fungus was arrested, but growth resumed when cultures were incubated at 20 C. After 10 d of incubation at 35 C, all three isolates failed to resume growth after additional 4 d incubation at 20 C and were presumably dead.
|
). In general isolate CLX2528 grew slower than the other two isolates.
Conidial germination.— –
Conidia of Ph. washingtonensis germinated by the formation of germ tubes (FIGS. 16 and 21) and by budding (FIGS. 16–20). At 20 C conidia produced germ tubes in 16–18 h in 1% pear-juice solution and 10–12 h in 10% pear-juice solution, and by budding in 16–22 h in 1% pear-juice solution and 18–22 h in 10% pear-juice solution. After 24 h of incubation, 11–18% and 22–44% of conidia germinated in 1% pear-juice solution by forming buds or germ tubes, respectively; 1–9% and 79–96% of conidia germinated in 10% pear-juice solution by budding or developing germ tubes, respectively; over 94% of conidia germinated by germ tubes, and no budding of conidia was observed in 100% pear-juice solution. After 36 h of incubation, budding of vegetative hyphae was commonly seen in 100% pear-juice solution.
After 48 h of incubation on WA at 20 C, both types of germination were common, and hyphae budded profusely. On PDA, 1% PJA and 20% PJA, conidia germinated by forming germ tubes, and budding was uncommon. However, budding of hyphae was common on 1% PJA after 48 h of incubation at 20 C but not on PDA and 20% PJA.
ITS sequencing.— –
Sizes of ITS amplicons were the same for both Ph. piri and Ph. washingtonensis. Amplicons were 466bp with ITS1 162bp, 5.8S 157bp and ITS2 147bp. All six isolates of Ph. washingtonensis had identical ITS sequences. BLAST searches using this sequence as the query sequence revealed no identical matches in GenBank. Four isolates of Potebniamyces pyri ( Ph. piri) from the Pacific Northwest and two from the CBS collection had identical ITS sequences, supporting the identities of these isolates. BLAST searches revealed no sequences identical to P. pyri. Four polymorphic nucleotide sites were found between Ph. washingtonensis and Ph. piri. Three of these sites occurred in the ITS1 region and one occurred in the ITS 2 region.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSTAXONOMYRESULTSDISCUSSIONLITERATURE CITED |
|---|
on Ph. malorum, now Ph. piri (DiCosmo et al 1984). To date all Phacidiopycnis species have teleomorphs referable to Potebniamyces Smerlis. The best known and most studied species is the type species, Potebniamyces pyri (Berk. & Broome) Dennis ( Phacidiopycnis piri [Fuckel] Weindlm.). Potebniamyces gallicola A. Funk & R.B. Sm., a parasite of dwarf mistletoe plants, has a Phacidiopycnis state (Funk and Smith 1981). In addition Sutton (1980) recognized Phacidiopycnis padwickii (Khesw.) B. Sutton and Phacidiopycnis tuberivora (Güssow & A.C. Foster) B. Sutton. Three taxa formerly considered to be Potebniamyces from conifers, P. balsamicola Smerlis ( Ph. balsamicola Funk) (Funk 1970, Smerlis 1962), P. coniferarum (Hahn) Smerlis ( Ph. pseudotsugae [Wilson] Hahn) (Hahn 1957, Smerlis 1962) and P. balsamicola var. boycei ( Ph. boycei [Hahn] Funk) (Funk 1970), were transferred to Phacidium Fr. by DiCosmo et al (1984). Likewise the anamorphs of these three taxa were excluded from Phacidiopycnis and placed in Apostrasseria Nag Raj (DiCosmo et al 1984, Nag Raj 1993). Ph. padwickii has irregular conidia reported as 10.5–14.5 x 4.5–12.5 µm, while Ph. tuberivora has fusiform conidia reported as 9.5–12 x 4.5–5.5 µm (Sutton 1980). The shapes and sizes of conidia of these two species are clearly different from Ph. washingtonensis. The Phacidiopycnis anamorph of P. gallicola has conidia reported as 6–7 x 3–4 µm, the general range of Ph. washingtonensis, but other characteristics indicate that the taxon is different (Funk and Smith 1981). Funk and Smith (1981) reported that conidia of P. gallicola are ellipsoid or inequilateral, apices acute or sometimes subappendiculate; the optimum temperature for growth of P. gallicola is 15 C with moderate growth at 20 C and no growth at 23 C; colonies of P. gallicola on 2% malt agar at 15 C attain approximately 70 mm in 14 d and become appressed and plumose as the culture darkens to blackish brown, which is different from Ph. washingtonensis. Ph. washingtonensis grows at 25 C and colonies attain 70 mm at 20 C in 7 d, indicating it grows much faster and has a wider temperature range for growth than P. gallicola. We accept Phacidiopycnis piri, Ph. Washingtonensis and the anamorph of Potebniamyces gallicola as Phacidiopycnis species but have not examined Ph. padwickii and Ph. tuberivora.
Phacidiopycnis piri is confined to members of Rosaceae (DiCosmo et al 1984). Ph. washingtonensis also is associated with members of Rosaceae. Both species are caulicolous and can cause fruit rot on apple during storage. The new taxon differs from Ph. piri in many characteristics. Conidia of Ph. washingtonensis are much smaller than Ph. piri, which are 9–14 x 5.5–9 (average 11.5 x 7.5) (DiCosmo et al 1984). Ph. washingtonensis grows more robustly on agar media than Ph. piri, which may be appressed and sectored (Brooks 1928, Xiao and Sitton 2004). Ph. piri does not grow or has a very limited growth on CDA (Xiao and Sitton 2004), whereas Ph. washingtonensis grows readily on CDA. The time required for sporulation on agar media is quite different between these two taxa. On PDA at 20 C under 12 h alternating cycles of dark and light Ph. piri forms pycnidia but the pycnidia do not produce conidia in 4 wk of incubation; in contrast Ph. washingtonensis produces abundant mature conidia in pycnidia after 7 d of incubation. In the dark at 20 C, Ph. piri does not form pycnidia on PDA after 4 wk of incubation (Xiao and Sitton 2004), whereas Ph. washingtonensis produces abundant pycnidia and mature conidia in 2 wk old PDA cultures. Although conidia of both Ph. piri and Ph. washingtonensis germinate in the same manner, by either budding or germ tubes, other aspects of germination differ substantially in response to nutrient. Budding is the primary manner of conidial germination in Ph. piri (Potebnia 1912, Southee and Brooks 1926, Liu and Xiao 2004). Liu and Xiao (2004) reported that the mode of conidial germination in Ph. piri is nutrient dependent; low nutrient levels favor budding and high nutrient levels favor the development of germ tubes (Liu and Xiao 2004). In 10% pear-juice solution, more than 80% of the conidia of P. piri germinate by budding (Liu and Xiao 2004), whereas more than 80% of the conidia of Ph. washingtonensis germinated by germ tubes. The teleomorph of Ph. piri may occur intermixed with the anamorph (Brooks 1928, DiCosmo et al 1984). The anamorph state of P. pyri is widespread in pear orchards in north-central Washington, and the teleomorph of the fungus also occurs on dead bark of pear trees but at a low frequency (Xiao and Boal 2004b). We have not found a teleomorph for Ph. washingtonensis based on a small-scale orchard survey in 2003.
All six isolates of Ph. washingtonensis recovered from different species of pome fruits were identical in ITS sequences, which had four nucleotides different from the type species, Ph. piri. The similarity in ITS sequences between the new taxon and Ph. piri reinforces the erection of a new species of Phacidiopycnis associated with pome fruits. The ITS sequence data also indicate that these two Phacidiopycnis species associated with pome fruits are closely related.
Phacidiopycnis rot caused by Potebniamyces pyri ( Ph. piri) has been recorded only in Europe (Snowdon 1990) and India (Sharma 1991). The disease more recently has been reported on pears in the United States (Xiao and Boal 2002, 2004a). Phacidiopycnis rot has been determined to be an important component of storage decay of d’Anjou pears, one of the major winter pear varieties grown in the U.S. (Xiao and Boal 2004a). Phacidiopycnis rot caused by Ph. piri also has been observed on apples in Washington but much less commonly (Xiao unpubl data). The newly recognized fruit rot disease caused by Ph. washingtonensis was observed on apple fruit in six of 26 grower lots (orchards) at a low level of incidence during the survey conducted from late June to early August 2003 (Kim and Xiao unpubl data). However in March 2004 an instance of severe decay caused by this fungus was observed on ‘Red Delicious’ apples after 6 mo of storage; 11% of the apples in storage bins were rotted by the fungus (Kim and Xiao unpubl data). This indicates that the fungus has the potential to cause severe fruit losses during storage. Although Ph. washingtonensis has been observed on dead twigs of d’Anjou pear trees in a research orchard, the fungus was not observed to cause decay on d’Anjou pears during a survey of postharvest diseases of d’Anjou pears conducted in 2001 and 2002 (Xiao and Boal 2004a). Because Ph. washingtonensis has the potential to cause significant economic losses of apple fruit during storage, further research is warranted to determine the distribution of the fungus in the region and the prevalence and incidence of this newly recognized fruit rot disease caused by the fungus.
It appears that the fungus is a low-temperature species because the fungus is able to grow at freezing temperatures and mycelial growth slows rapidly when the temperature increases from 20 to 25 C (FIG. 22). Apples are stored commercially at –1–4 C (Meheriuk 1993). This study showed that Ph. washingtonensis grows at temperatures as low as –3 C, indicating the disease cannot be prevented by the temperatures commercially used for storage of apples.
Crabapple has been used commonly as a source of pollen in apple production and might account for 5–10% of the trees in apple orchards. We have observed fruiting bodies of the fungus on dead crabapple twigs, and the fungus has been isolated from the margin between diseased and healthy tissues of crabapple twigs with dieback and canker symptoms. We have not observed the fungus on apple trees, based upon a limited number of observations. Crabapple is suspected as one of the sources of inoculum for infection leading to fruit rot on apples during storage. Pathogenicity of Ph. washingtonensis on twigs of crabapple and apple trees has not been tested. Research is needed to determine whether the fungus is the primary cause of the dieback and canker of crabapple twigs and whether the fungus is pathogenic to apple trees.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Corresponding author. Email: clxiao{at}wsu.edu
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSTAXONOMYRESULTSDISCUSSIONLITERATURE CITED |
|---|
DiCosmo F, Nag Raj TR, Kendrick WB. 1984. A revision of the Phacidiaceae and related anamorphs. Mycotaxon 21:1–234.
Funk A. 1970. Taxonomy of Phomopsis boycei and its relationship to Potebniamyces balsamicola. Can J Bot 48: 1013–1025.
———, Smith RB. 1981. Potebniamyces gallicola n. sp., from dwarf mistletoe infections in western hemlock. Can J Bot 59:1610–1612.
Hahn GG. 1957. A new species of Phacidiella causing the so-called Phomopsis disease of conifers. Mycologia 49: 227–239.
Holmgren PK, Holmgren NH, Barnett LC. 1990. Index herbariorum. Part I: The herbaria of the world. 8th ed. New York Botanical Garden, Bronx, New York. 693 p.
Lee SB, Taylor JW. 1990. Isolation of DNA from fungal mycelia and single spores. In: PCR Protocols: a guide to methods and applications. Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. San Diego, California: Academic Press. p 282–287.
Liu Q, Xiao CL. 2004. Influence of nutrient and environmental factors on conidial germination of Potebniamyces pyri. Phytopathology 94:S62.
Meheriuk M. 1993. CA storage conditions for apples, pears, and nashi. In: Proceedings from the Sixth International Controlled Atmosphere Research Conference, Cornell University, Ithaca, New York. p 819–841.
Nag Raj TR. 1993. Coelomycetous anamorphs with appendage-bearing conidia. Waterloo, Ontario: Mycologue Publications.
Potebnia A. 1912. Ein neuer Krebserreger des Apfelbaumes Phacidiella discolor (Mout. Et Sacc.) A. Pot., seine Morphologie und Entwickelungsgeschichte. Zeit f Pflanzenkrank . 22:129–153.
Rayner RW. 1970. A mycological colour chart. Commonwealth Mycological Institute, Kew.
Sharma RL. 1991. Prevalence of storage rots of China pear in Himachal Pradesh. Pl Dis Res 5:109–111.
Smerlis E. 1962. Taxonomy and morphology of Potebniamyces balsamicola sp. nov. associated with a twig and branch blight of balsam fir in Quebec. Can J Bot 40: 351–359.
Snowdon AL. 1992. Post-harvest diseases and disorders of fruits and vegetables. Vol. 1. General introduction and fruits. Boca Raton, Florida : CRC Press Inc. 302 p.
Southee EA, Brooks FT. 1926. Notes on a pycnidial fungus associated with a dying-back of apple branches. Trans Brit Mycol Soc 11:213–219.
Stahl SA, Rogers JD, Adams MJ. 1988. Observations on Hendersonia pinicola and the needle blight of Pinus contorta. Mycotaxon 31:323–337.
Sutton BC. 1980. The coelomycetes. Commonwealth Mycological Institute, Kew.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The Clustal X windows interface: flexible strategies for multiple sequences alignment aided by quality analysis tools. Nuclei Acids Res 24:4876–4882.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego, California: Academic Press. p 315–322.
Xiao CL, Boal RJ. 2002. Pathogenicity and infection courts of Phacidiopycnis piri in pears. Phytopathology 92:S88.
———, ———. 2004a. Prevalence and incidence of Phacidiopycnis rot in d’Anjou pears in Washington State. Plant Dis 88:413–418.[CrossRef]
———, ———. 2004b. Inoculum availability and seasonal survival of Potebniamyces pyri in pear orchards. Phytopathology 94:S112.
———, Sitton JW. 2004. Effects of culture media and environmental factors on mycelial growth and pycnidial production of Potebniamyces pyri. Mycol Res 108:926–932.[CrossRef][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
