Mycologia
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

DOI: 10.3852/mycologia.97.1.99
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Slippers, B.
Right arrow Articles by Wingfield, M. J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Slippers, B.
Right arrow Articles by Wingfield, M. J.
Agricola
Right arrow Articles by Slippers, B.
Right arrow Articles by Wingfield, M. J.
Mycologia, 97(1), 2005, pp. 99-110.
© 2005 by The Mycological Society of America

Phylogenetic and morphological re-evaluation of the Botryosphaeria species causing diseases of Mangifera indica


Bernard Slippers 1

     Department of Microbiology and Plant Pathology, Forestry and Agricultural Biotechnology Institute, Faculty of Natural and Agricultural Sciences, University of Pretoria, Pretoria, South Africa

Greg I. Johnson

     ACIAR, P.O. Box 1571, Canberra, ACT 101, Australia

Pedro W. Crous

     Centraalbureau voor Schimmelcultures, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands

Teresa A. Coutinho
Brenda D. Wingfield
Michael J. Wingfield

     Department of Microbiology and Plant Pathology, and Department of Genetics, Forestry and Agricultural Biotechnology Institute, Faculty of Natural and Agricultural Sciences, University of Pretoria, Pretoria, South Africa

    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 KEY TO BOTRYOSPHAERIA SPP....
 DISCUSSION
 LITERATURE CITED
 

Species of Botryosphaeria are among the most serious pathogens that affect mango trees and fruit. Several species occur on mangoes, and these are identified mainly on the morphology of the anamorphs. Common taxa include Dothiorella dominicana, D. mangiferae (= Natrassia mangiferae), D. aromatica and an unidentified species, Dothiorella ‘long’. The genus name Dothiorella, however, is acknowledged as a synonym of Diplodia. This study aimed to characterize and name the Botryosphaeria spp. associated with disease symptoms on mangoes. To achieve this isolates representing all four Dothiorella spp. mentioned above were compared with the anamorphs of known Botryosphaeria spp., based on conidial morphology and DNA sequence data. Two genomic regions were analyzed, namely the ITS rDNA and ß-tubulin regions. The morphological and molecular results confirmed that the fungi previously identified from mango as species of Dothiorella belong to Fusicoccum. Dothiorella dominicana isolates were identical to isolates of F. parvum (teleomorph = B. parva). A new epithet, namely F. mangiferum, is proposed for isolates previously treated as D. mangiferae or N. mangiferae. Isolates of D. aromatica were identified as F. aesculi (teleomorph = B. dothidea). A fourth Fusicoccum sp. also was identified as those isolates previously known as Dothiorella ‘long’. A key is provided to distinguish these species based on anamorph morphology in culture. This study provides a basis for the identification of Botryosphaeria species from mango, which is important for disease control and to uphold quarantine regulations.

Key words: Conidia, dieback, Fusicoccum, identification, mango, phylogeny, soft rot, stem-end rot, taxonomy


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 KEY TO BOTRYOSPHAERIA SPP....
 DISCUSSION
 LITERATURE CITED
 
Stem-end rot of mango (Mangifera indica L.) fruit is one of the most serious post harvest diseases affecting this industry worldwide (Prakash and Srivastava 1987Go, Cappellini et al 1988Go, Prusky 1991Go, Mitra and Baldwin 1997Go). This disease is caused by a complex of fungal pathogens, of which various Botryosphaeria spp. dominate (Darvas 1991Go; Johnson et al 1991aGo, bGo, 1992Go; Sangchote 1991Go). Apart from fruit diseases, Botryosphaeria spp. also cause tip- and branch dieback and cankers on mango trees (Stevens 1926Go, Ramos et al 1991Go). These fungi live endophytically in healthy tissue of all parts of mango plants and mostly cause disease after stress to the trees or fruit after harvest ( Johnson et al 1991aGo, 1992Go; Sangchote 1991Go).

Botryosphaeriaceous fungi considered as pathogens of mango trees and fruit are best known by their anamorph states. Some of the most commonly encountered species are Dothiorella dominicana Petr. & Cif., D. mangiferae Syd. & P. Syd., D. aromatica (Sacc.) Petr. & Syd. and an unnamed species, Dothiorella ‘long’ ( Johnson 1992Go). These names, however, are in need of revision. Dothiorella mangiferae has been reduced to synonymy under Nattrassia mangiferae (Syd. & P. Syd.) Sutton & Dyko (Sutton and Dyko 1989Go). This synonymy has been recognized by some researchers (Londsdale 1992, Roux 1993Go) but disputed by others ( Johnson 1991aGo, bGo, 1992Go). In addition the type species of Dothiorella was synonymized recently under Diplodia, raising questions about the correct generic affinities of all species presently placed in Dothiorella (Crous and Palm 1999Go).

Not all Dothiorella spp. are of equal importance as pathogens of mango. Dothiorella dominicana is the most common pathogen and causes significant losses annually (Darvas 1991Go, Johnson et al 1991aGo). Dothiorella mangiferae is found on mango trees worldwide, especially in Australia and Thailand (Sydow et al 1916Go; Johnson et al 1991aGo, 1992Go; Mitra and Baldwin 1997Go). Dothiorella aromatica (Sacc.) Petr. & Syd., and an unnamed species, Dothiorella ‘long’, occasionally have been recorded from mango in Thailand and Australia but are of less importance ( Johnson et al 1991aGo, Johnson 1992Go). Dothiorella aromatica has been reported from mango but is better known as a pathogen of avocado ( Johnson 1992Go, Johnson et al 1992Go, Hartill 1991Go).

It has been suggested that all Dothiorella spp. occurring on mango should be accommodated in the genus Fusicoccum ( Johnson 1992Go). In that study it is suggested that D. dominicana is a synonym of F. aesculi Corda (B. dothidea [Fr. : Moug.] Ces. & De Not.), and that D. aromatica should be placed in Fusicoccum with F. luteum Pennycook & Samuels as a synonym. He also suggested that D. mangiferae should be recombined in Fusicoccum as the anamorph of B. parva Pennycook & Samuels, and that Dothiorella ‘long’ is F. cajani (Syd., P. Syd. & E.J. Butler) Samuels & Singh (teleomorph B. xanthocephala [Syd., P. Syd. & E.J. Butler] Theissen). The new taxonomic combinations, however were, not formally proposed.

Other researchers have reported species of Fusicoccum from mango and avocado. Hartill (1991)Go examined botryosphaeriaceous fungi from avocado in New Zealand that had been described previously as Dothiorella species. He concluded that they were either F. aesculi, F. parvum Pennycook & Samuels or F. luteum. In California Ramos et al (1991)Go observed the Fusicoccum anamorph of B. ribis Grossenb. & Duggar from mango plants.

Anamorph morphology is used commonly to identify species of Botryosphaeria (Shoemaker 1964Go, Pennycook and Samuels 1985Go, Jacobs and Rehner 1998Go, Slippers et al 2004Go). The morphological distinctions of the anamorphs of some of the closely related species, however, are not clear. Recent studies using DNA sequence data have highlighted taxonomic groups and relationships in Botryosphaeria ( Jacobs and Rehner 1998Go, Denman et al 2000Go, Smith et al 2001Go, Smith and Stanosz 2001Go, Zhou and Stanosz 2001Go, Slippers et al 2004Go). These data combined with morphological characteristics could clarify the current taxonomic confusion. There is a clear need to use the same approach to clarify the relationships and identities of the stem-end rot pathogens of mango.

The aim of this study was to re-evaluate the status of the anamorph names of Botryosphaeria species from mango in Australia and determine their relation to other Botryosphaeria spp. DNA sequence data from the internal transcribed spacer regions (ITS1 and ITS2) and 5.8S gene of the rRNA operon and the ß-tubulin gene were used in combination with morphological characteristics to characterize and name the different ‘Dothiorella spp. The taxonomy of B. rhodina (Berk. & Curt.) von Arx (anamorph = Lasiodiplodia theobromae [Pat.] Griffon & Maubl.), another Botryosphaeria sp. that commonly occurs on mango in Australia, is not considered in this study.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 KEY TO BOTRYOSPHAERIA SPP....
 DISCUSSION
 LITERATURE CITED
 
Isolates and morphological characterization.— – A total of 14 single-spore isolates from stem-end rot lesions on mango fruit or from necrotic twigs were used in this study (TABLE IGo). These isolates previously had been characterized based on morphology by Johnson (1992)Go. In the current study the isolates were induced to sporulate on water agar amended with pine needles as substratum and exposed to near UV light for a 12 h cycle at 20–25 C for up to 1 mo. Pycnidia and conidia were mounted in lactophenol. At least 50 conidia were measured for each species.


View this table:
[in this window]
[in a new window]
 
TABLE I. Isolates from mango fruit and trees considered in the phylogenetic study
 
Molecular characterization.— – A phenol : chloroform DNA extraction technique was used to isolate the genomic DNA, as described in Raeder and Broda (1985)Go and Smith et al (2001)Go. Partial sequences from two housekeeping gene regions were used for phylogenetic comparisons between isolates. First, the region spanning the 3' end of the 16S (small subunit) rRNA gene, the first internal transcribed spacer (ITS1), the complete 5.8S rRNA gene, the second ITS (ITS2) and the 5' end of the 26S (large subunit) rRNA gene, was amplified using the primers ITS1 (5'TCCGTAG GTGAACCTGCGG 3') and ITS4 (5'TCCTCCGCTTATTG ATATGC 3') (White et al 1990Go). Second, a part of the ß-tubulin gene was amplified using the primers Bt2a (5'GG TAACCAAATCGGTGCTGCTTTC 3') and Bt2b (5'ACCCT CAGTGTAGTGACCCTTGGC 3') (Glass and Donaldson 1995Go). PCR reaction mixtures, PCR conditions and visualization of amplicons were as described in Slippers et al (2004)Go. ITS and ß-tubulin PCR amplicons were purified and sequenced as described in Slippers et al (2004)Go.

To compare the sequence data determined in this study with those of known taxa, 15 ITS rDNA sequences and 15 ß-tubulin sequences obtained from GenBank were included in the analyses (TABLE IGo). These sequence data included those of B. dothidea, B. ribis and B. parva from a study of type material and ex-type cultures (Slippers et al 2004Go), as well as other sequence data of related Botryosphaeria spp. ( Jacobs and Rehner 1998Go, Smith et al 2001Go, Smith and Stanosz 2001Go, Zhou and Stanosz 2001Go). BLAST searches were done to identify any other related sequence data to the fungi studied here. A Bionectria sp. was included as an out-group taxon in the analyses. Despite the relationship between outgroup and ingroup taxa, unambiguous alignment of intron regions of the outgroup sequence with the in-group was not always possible, due to the high degree of sequence variation within these regions. Analysis with and

Sequence data determined in this study were analyzed using Sequence Navigator 1.0.1TM (Perkin Elmer Applied Biosystems, Foster City, California). These data were aligned manually with each other and with the data obtained from GenBank by inserting gaps. Gaps were treated as a fifth character, and all characters were unordered and of equal weight. Partition homogeneity tests (Farris et al 1995Go, Huelsenbeck et al 1996Go) were run in PAUP (Phylogenetic Analysis Using Parsimony) 4.0b8 (Swofford 1999Go) to determine whether the ITS rDNA and ß-tubulin sequence datasets were congruent and, therefore, combinable. These data then were analyzed together to determine possible phylogenetic relationships among the taxa using parsimony in PAUP. To construct maximum parsimonious trees from the data, heuristic searches were done using informative characters and stepwise (random) addition and tree bisection and reconstruction (TBR) as branch-swapping algorithm. MaxTrees were unlimited, branches of zero length were collapsed and all multiple, equally parsimonious trees were saved. Levels of homoplasy and phylogenetic signal (retention and consistency indices and g1-value) (Hillis and Huelsenbeck 1992Go) were determined. Branch and branch node supports were determined using 1000 bootstrap replicates (Felsenstein 1985Go) and decay analysis of the branch nodes using Autodecay (Eriksson 1998Go).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 KEY TO BOTRYOSPHAERIA SPP....
 DISCUSSION
 LITERATURE CITED
 
Isolates and morphological characterization.— – The isolates used in this study had been maintained in culture for an extended period of time and subcultured extensively. Many of the cultures grew poorly and isolates did not sporulate as readily on pine needles as observed previously with freshly isolated strains (Slippers et al 2004Go). Nevertheless, all species sporulated on the needles in 1–4 wk. Pycnidia were spherical (150–400 µm), with an apical papilla, with or without a conical neck (50–200 µm), semi-immersed to superficial on the needle surfaces and mostly occurred singly (FIG. 1Go). The apical papilla often was inconspicuous due to dense growth of gray mycelium covering the pycnidia.



View larger version (99K):
[in this window]
[in a new window]
 
FIGS. 1–7. Anamorphs of Botryosphaeria spp. formed in culture. 1. Fusicoccum mangiferum (CMW7024) pycnidium forming on a pine needle. Bar = 100 µm. 2. Fusicoccum parvum (CMW7025) conidia and spermatia. 3, 4. Young, aseptate conidia of F. mangiferum (CMW7024), become septate and discolored after discharge. 5. Toruloid cells of F. mangiferum (CMW7024). 6. Fusiform conidia of F. aesculi (CMW7803). 7. Rod-shaped conidia of a Fusicoccum sp. (CMW7022) Bars = 10 µm.

 
The four taxa represented by the isolates were distinguished by conidial size and shape (TABLE IIGo) (KEY) (FIGS. 2–7Go). Isolates previously identified as D. dominicana had fusiform to ellipsoid, hyaline conidia (average of 56 conidia = 19 x 5.2 µm). These conidia were observed infrequently to become 1–2 euseptate, often with a darker brown middle cell. Such septate, versicolored spores usually were observed after discharge from the pycnidia or on material that had been left to dry. These conidia are similar to those reported to be F. parvum (TABLE IIGo). Conidia of isolates previously identified as D. mangiferae were similar in shape, septation and color to those of D. dominicana but were smaller (average of 54 conidia = 13.6 x 5.4 µm). Dark brown mycelial, toruloid cells were observed infrequently on pine needles or in culture. Isolates identified as D. aromatica produced long, fusiform conidia (average of 59 conidia = 23 x 5.1 µm). These isolates were similar to those reported as F. aesculi, the anamorph of B. dothidea (TABLE IIGo). Isolates previously identified as D. ‘long’ also produced long conidia but differed from the last named taxon by their broader, rod-shaped conidia (average of 59 conidia = 26.6 x 6 µm).


View this table:
[in this window]
[in a new window]
 
TABLE II. Conidial measurements for Botryosphaeria spp. and their Fusicoccum anamorphs associated with mango
 
Molecular characterization.— – Amplicons of about 550 bp were obtained using the primers ITS1 and ITS4 and approximately 450 bp using the primers Bt2a and Bt2b. Approximately 25 bp of the terminal end sequence data were excluded in each case in the final alignments (GenBank 1216767–1216792, TABLE IGo). The total aligned sequence dataset had 1016 characters (TreeBASE matrix accession number = M1883). Only the 260 parsimony informative characters were included in the analysis.

A partition homogeneity test showed that the ITS rDNA and ß-tubulin datasets were congruent (P value = 0.2). Evaluation of random trees showed that the combined datasets contained significant phylogenetic signal (P < 0.01; g1 = –0.72) (Hillis and Huelsenbeck 1992Go). Heuristic searches found two equal, most parsimonious trees (tree length = 544 steps; CI = 0.746; RI = 0.885) (TreeBASE Study accession number = S1101) (FIG. 8Go). The nine clades in these trees were identified as: clade I = B. ribis, clade II = B. parva, clade III = F. mangiferum, clade IV = B. eucalyptorum Crous, H. Smith & M.J. Wingf., clade V = B. lutea A.J.L. Phillips, clade VI = Fusicoccum sp., clade VII = B. dothidea, clade VIII = B. obtusa (Schwein.) Shoemaker and B. stevensii Shoemaker, and clade IX = B. rhodina. All were supported by high bootstrap values (>99%).



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 8. One of the two equal, most parsimonious trees obtained by heuristic searches of the ITS rDNA and ß-tubulin sequence datasets in PAUP. Branch supports are indicated by decay indices below and bootstrap values above the branches. Nine clades or taxa are identified. Clade VI represents an unknown Fusicoccum sp. (previously identified as Dothiorella ‘long’).

 
Clades I–VII all represent Botryosphaeria spp. with Fusicoccum anamorphs and formed a monophyletic group supported by a 100% bootstrap value. Within this group, clades I–II (B. ribis, B. parva) grouped together (100% bootstrap), and these two clades were related most closely to clades III–V (F. mangiferum, B. eucalyptorum and B. lutea) with 85% bootstrap support. Clade VI (undescribed Fusicoccum sp.) and clade VII (B. dothidea) grouped apart from the other groupings. There was sequence variation among isolates within each of clades VI and VII. The variation in clade VI is in the ß-tubulin region in only one isolate (CMW7023). The variation within clade VII is in two bases located in a repetitive G (nine repeats) and C (10 repeats) rich area in the ITS1 region. Clade VIII and IX represent Botryosphaeria spp. with Diplodia-like conidia.


    TAXONOMY
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 KEY TO BOTRYOSPHAERIA SPP....
 DISCUSSION
 LITERATURE CITED
 
Four botryosphaeriaceous fungi were identified in this study from mango. Two species have known teleomorphs, B. parva and B. dothidea. Johnson (1992)Go provisionally suggested a new combination in the genus Fusicoccum for the fungus reported as Dothiorella mangiferae or Natrassia mangiferae from mango and other hosts. That proposal is supported by molecular and morphological data obtained in this study and a new combination is proposed formally here. The fourth distinct species is identified only as a species of Fusicoccum.

1. Botryosphaeria parva Pennycook & Samuels, Mycotaxon 24:455. 1985.

Anamorph. Fusicoccum parvum Pennycook & Samuels, Mycotaxon 24:455. 1985. FIG. 2Go

Notes. – The anamorph state of B. parva has been identified commonly from mango as D. dominicana. The conidia from putative D. dominicana isolates collected from mango in Australia ( Johnson 1992Go) are identical to those reported from the type of F. parvum (Pennycook and Samuels 1985Go, Slippers et al 2004Go). The data from these studies (TABLE IIGo) show that this taxon can be distinguished from other botryosphaeriaceous fungi on mango by conidial characteristics. The most recognizable characteristics of these conidia are that they are aseptate, hyaline, granular, broadly ellipsoid to fusoid, on average 17–19 x 5–6 µm (see KEY). Older, discharged conidia sometimes become 1–2-septate and light brown with darker middle cells. Septate conidia with distinctly darker middle cells in this fungus have been confused with N. mangiferae and D. mangiferae (Sutton and Dyko 1989Go, Roux 1993Go).

Although the mango isolates identified as D. dominicana are here conspecific with B. parva, the true identity of the type of D. dominicana remains unclear. The dimensions reported in the original description of D. dominicana from mango leaves by Petrak and Ciferri (1930)Go fall within the range of F. parvum. Johnson (1992)Go re-examined and described the type material of D. dominicana, which he considered to be synonymous with B. dothidea. The conidia reported by Johnson (1992)Go from the D. dominicana type material, however, are smaller than the anamorphs of either B. dothidea or B. parva. Despite this uncertainty, it is clear that the name D. dominicana is not appropriate for isolates associated with stem-end rot and other diseases of mango in Australia.

2. Fusicoccum mangiferum (Syd. & P. Syd.) Johnson, Slippers & M.J. Wingf. comb. nov. FIGS. 3–5Go

Basionym. Dothiorella mangiferae Syd. & P. Syd., In H. Sydow, P. Sydow & Butler, Ann. Mycol. 14:192. 1916.

Synonyms. Natrassia mangiferae (Syd. & P. Syd.) B. Sutton & Dyko, Mycol. Res. 93:484. 1989.

Hendersonula toruloidea Natrass, Trans. Br. Mycol. Soc. 18:197. 1933.

Hendersonula cypria Natrass, Cypress fungi, Nicosia: 43. 1937.

Synanamorph. Scytalidium dimidiatum (Penz.) B. Sutton & Dyko, Mycol. Res. 93:484. 1989.

Teleomorph. Botryosphaeria sp.

Notes. – Various morphological descriptions have been given for this taxon. The species was described first by Sydow et al (1916)Go from M. indica in India. Sutton and Dyko (1989)Go studied the holotype and the types of H. toruloidea connected with this taxon, including the holotype, and provided a very thorough description. Other clear descriptions are found in Natrass (1933)Go, Punithalingam and Waterston (1970)Go and Johnson (1992)Go.

Duplication of previous descriptions is avoided here, but the most distinctive features are highlighted. The conidia of F. mangiferum are distinct from other Fusicoccum spp. by their shorter average length (~13–14 µm) and smaller length/width ratio (2–2.5) (see KEY). The conidia often become 1- or 2-septate, light brown with distinctly darker middle cells. This feature is shared also with F. parvum. Fusicoccum mangiferum produces vegetative, toruloid cells in culture and in nature. This species also produces fluffy, evenly gray-colored aerial mycelium, lacking the white tufts found in other similar species such as F. parvum.

Sydow et al (1916)Go described D. mangiferae from mango but noted only the aseptate conidia. Re-examination of the type material, however, confirmed the presence of 1–2-septate, pigmented conidia (Sutton and Dyko 1989Go). It is possible that the spores on the type material aged and became septate after the description by Sydow. Natrass (1933)Go studied the taxon from pome and stone fruit trees and first noticed the pigmented conidia, which led him to describe it as Hendersonula toruloidea Natrass. He also studied the fungus in culture and noted the characteristic brown 1- or 2-celled, toruloid, vegetative cells. Sutton and Dyko (1989)Go synonymized both D. mangiferae and H. toruloidea with Natrassia mangiferae.

Natrass (1933)Go and Sutton and Dyko (1989)Go reported fragmented mycelial cells or toruloid cells in culture and in nature. In the last named study, this form was described as the synanamorph Scytalidium dimidiatum. Johnson (1992)Go reported no toruloid state but referred only to these cells as fragmented mycelia and he did not use the last named epithet. The cells described by Natrass (1933)Go and Sutton and Dyko (1989)Go rarely were observed in this study and when seen, resembled fragmented, thick-walled hyphae.

Sutton and Dyko (1989)Go reduced Fusicoccum eucalypti Sousa da Câmara and H. agathi to synonymy with F. mangiferum (as N. mangiferae). These synonymies are not accepted here because the conidia of both taxa differ from those of F. mangiferum in length and in length/width ratio (Young 1948Go, Sutton and Davison 1983Go, Sutton and Dyko 1989Go). The conidial sizes reported in these studies for F. eucalypti and H. agathi were more similar to those of F. parvum.

The teleomorph of F. mangiferum is a Botryosphaeria sp. The DNA sequence data presented here group this species with the type species B. dothidea and other Botryosphaeria sp. Johnson (1992)Go also reported Botryosphaeria ascomata and ascospores forming in cultures of F. mangiferum ( Johnson 1992Go). Sufficient material, however, was not available to describe formally a specific name for the teleomorph.

3. Botryosphaeria dothidea (Moug. : Fr.) Ces. & De Not., Comment. Soc. Crittog. Ital. 1:212. 1863.

Anamorph. Fusicoccum aesculi Corda in Sturm, Deutschl. Fl., Abth. 3, 2:111. 1829. FIG. 6Go

Notes. – Previous reports of this fungus from mango and avocado were misidentified as D. aromatica. Conidial morphology of this species as described from mango is similar to that described for the anamorph of B. dothidea (Pennycook and Samuels 1985Go, Slippers et al 2004Go). The most distinctive feature of this taxon is its conidia, which are aseptate, hyaline, fusiform to narrowly fusiform and on average 23–25 x 4–5 µm (see KEY).

The type specimen of D. aromatica (Sacc.) Petr. & Syd. (= Macrophoma aromatica Sacc.) (Saccardo 1915Go, Petrak and Sydow 1927Go) was obtained from PAD (497) on Perseae gratissimae (avocado) leaves. The conidia are fusiform, aseptate and 20–22 x 6–7 µm and most closely resemble those of F. luteum (Pennycook and Samuels 1985Go, Phillips et al 2002Go). Fusicoccum luteum also has been reported from avocado (Hartill 1991Go, Johnson 1992Go). We, therefore, consider D. aromatica to be a synonym of F. luteum. Although the type specimen of D. aromatica does not resemble F. aesculi (Crous and Palm 1999Go, Slippers et al 2004Go), the fungus occurring as a pathogen of mango and generally misidentified as D. aromatica is F. aesculi.

4. Fusicoccum sp. FIG. 7Go

Notes. – Johnson et al (1991a)Go and Johnson (1992)Go identified an unknown Dothiorella or Fusicoccum sp. from mango in Australia and Thailand, which was referred to only as Dothiorella ‘long’. DNA sequence and morphological data presented here confirm that isolates defined as Dothiorella ‘long’ represent one, probably undescribed Fusicoccum sp.

Johnson (1992)Go considered this Fusicoccum sp. as possibly synonymous with F. cajani (teleomorph = B. xanthocephala). Samuels and Singh (1986)Go described F. cajani causing stem canker in Cajanus spp. (pigeon pea) from Fiji, India and the USA. Conidial measurements of F. cajani [(17–)21.6–27.8(–32) x (5–) 6.5–8(–9) µm] and the Fusicoccum sp. (average = 26.6 x 6 µm, see TABLE IIGo) considered here, overlap. This alone, however, is not sufficient evidence for synonymy. For example, the measurements and the shape of the conidia of F. cajani overlap with the anamorphs of a number of other Botryosphaeria spp., such as B. lutea (Pennycook and Samuels 1985Go, Phillips et al 2002Go), B. eucalyptorum (Smith et al 2001Go), B. protearum Denman and Crous (Denman et al 2003Go) and others. Given differences in hosts and diseases, it is unlikely that Dothiorella ‘long’ is F. cajani. No isolates of B. xanthocephala could be located to further test this hypothesis, using molecular or cultural characters.


    KEY TO BOTRYOSPHAERIA SPP. AND THEIR ANAMORPHS FROM MANGO IN AUSTRALIA
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 KEY TO BOTRYOSPHAERIA SPP....
 DISCUSSION
 LITERATURE CITED
 
Conidial characters are used to separate the botryosphaeriaceous fungi treated here. The anamorph is encountered most frequently in nature and also is induced readily in vitro on nutrient-poor medium (e.g., water agar) supplemented with sterilized pine needles. Differences among the species are more pronounced in anamorph than teleomorph features. Teleomorphs have not been described or observed for all the species treated here, but teleomorph names are used preferentially where they are known. The unnamed species of Fusicoccum refers to the fungus previously known as Dothiorella ‘long’.


1. Conidia in culture on average <20 µm in length, l/w 2–3.5, occasionally becoming light brown and 1–2-septate with a darker brown middle cell after discharge, colony on MEA or PDA thick felt of gray aerial mycelium 2
1. Conidia in culture on average >20 µm in length, l/w >4, colony on MEA or PDA appressed with only occasional tufts of gray to buff aerial mycelium 3
    2. No toruloid cells; conidia 12–23 x 4–6 µm (average 19 x 5.2 µm), l/w 3–3.5 B. parva
    2. Toruloid cells; conidia 12–14 x 4–6 µm (average 13.6 x 5.4 µm), l/w 2–3 F. mangiferum
3. Conidia rod-shaped, 20–32 x 5–7 µm (average 26.6 x 6 µm), l/w 3.5–4.5 Fusicoccum sp.
3. Conidia narrowly fusiform, 19–30 x 4–6 µm (average 23 x 5.1 µm), l/w 4–5 B. dothidea


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 KEY TO BOTRYOSPHAERIA SPP....
 DISCUSSION
 LITERATURE CITED
 
Four Fusicoccum spp. were identified as endophytes and pathogens of Australian mango fruit and trees in the current study. Identification of these species is based on a combination of morphological and molecular phylogenetic analyses. These species are F. parvum (teleomorph B. parva), F. mangiferum, F. aesculi (teleomorph B. dothidea) and an undescribed Fusicoccum sp. They all were identified previously from mango as species of Dothiorella or Natrassia. This study shows that all are species of Fusicoccum and that their teleomorphs are most likely Botryosphaeria.

The description of Dothiorella spp. from mango as Fusicoccum spp. is in accordance with recent proposals for the correct use of these two generic names (Crous and Palm 1999Go, Denman et al 2000Go). Fusicoccum and Dothiorella often have been confused because both have been used commonly to describe anamorphs of Botryosphaeria (Saccardo 1882Go, Petrak 1922Go, von Arx and Müller 1954Go). The common use of the name Dothiorella for suspected Botryosphaeria anamorphs from mango follows Sydow et al (1916)Go and Petrak (1922)Go. D. pyrenophora Sacc., the type species of Dothiorella, recently was redescribed as Diplodia pyrenophora (Sacc.) Crous & M.E. Palm (Crous and Palm 1999Go). These authors suggested that all Botryosphaeria anamorphs that are placed in Dothiorella should be re-examined. Denman et al (2000)Go argued that all hyaline, thin-walled fusiform conidial Botryosphaeria anamorphs are Fusicoccum.

Results of this study and those of Johnson (1992)Go show clearly that B. parva (reported as D. dominicana) is one of the most common pathogens of mango causing fruit stem-end rot, dieback and blossom blight. The species first was described by Pennycook and Samuels (1985)Go from Populus, Malus and Actinidia species in New Zealand. It subsequently was shown that this species occurs worldwide on a number of hardwood species, including native Australian flora such as Eucalyptus spp. (Slippers et al 2004Go). Botryosphaeria parva often has been misidentified as B. ribis and B. dothidea due to overlapping host ranges, morphological similarities and taxonomic confusion over the use of the names (Slippers et al 2004Go). Thus it also is likely that the fungus described as B. ribis from mango in Florida (Ramos et al 1991Go) is B. parva. These identifications from Florida were based on conidial dimensions, which overlap between B. ribis and B. parva (Slippers et al 2004Go).

The name F. mangiferum has been proposed in this study for the mango pathogen that previously was identified as D. mangiferae and Natrassia mangiferae. Johnson (1992)Go first suggested that D. mangiferae and N. mangiferae should be placed in Fusicoccum. This proposal is supported in the current study by the phylogenetic monophyly of this taxon with the type species F. aesculi and other Fusicoccum spp. Isolates used for sequence analyses were not ex-type cultures. The conidia of these isolates were, however, morphologically indistinguishable from the type specimens of D. mangiferae (Sutton and Dyko 1989Go, Sydow et al 1916Go).

The septation and pigmentation of conidia of F. mangiferum and F. parvum have obvious similarities. This has led to confusion between these taxa in the past. These species, however, can be separated by conidial size because conidia of the former species are smaller in average length and width. Moreover in culture F. parvum has fluffier aerial mycelium than the appressed gray aerial mycelium of F. mangiferum.

Botryosphaeria dothidea is of little importance as a pathogen of mango in Australia or other parts of the world. It is less common on mango than B. parva and F. mangiferum and is omitted often from lists of important pathogens of this host ( Johnson et al 1991aGo, bGo, 1992Go; Johnson 1992Go). This name, however, is one of the most commonly used for Botryosphaeria pathogens on a wide variety of other hosts (Mc-Glohon 1982Go, Pennycook and Samuels 1985Go, Brown and Britton 1986Go, Hartill 1991Go, Jacobs and Rehner 1998Go, Smith et al 2001Go). Some of these identifications need to be viewed with care because many species have been relegated incorrectly to the name B. dothidea. This followed the extensive synonymy of many species with B. dothidea by von Arx and Müller (1954)Go. Due to this synonymy, B. ribis was treated as a synonym of B. dothidea. Botryosphaeria parva often was not distinguished from B. ribis and consequently was treated also under B. dothidea (Slippers et al 2004Go).

Reports of B. dothidea from Australasia and other Southern Hemisphere countries are from exotic hosts (Pennycook and Samuels 1985Go, Hartill 1991Go, Slippers et al 2004Go). Studies of pathogens of native hosts in Australasia have not reported this pathogen (Denman et al 2003Go). This species, however, is common on both cultivated and indigenous hosts in the Northern Hemisphere (Zhou and Stanosz 2001Go, Slippers et al 2004Go). This suggests a Northern Hemisphere origin for this fungus and implies that it was introduced into the Southern Hemisphere with planting material of agricultural crops.

The taxon previously known from mango as Dothiorella ‘long’ is identified in this study as an undescribed species of Fusicoccum. This species was found rarely in extensive surveys during previous studies and is not considered important in causing pre- or postharvest diseases of mango ( Johnson et al 1991aGo, Johnson 1992Go). This species of Fusicoccum is not known from any other hosts. Further collections and studies are needed to understand the distribution and biology of this fungus.

Johnson (1992)Go suggested that F. luteum (teleomorph B. lutea) occurs on mango in Australasia. None of the Fusicoccum spp. from mango in Australia group with this taxon, based on DNA sequence data produced in this study. This finding is surprising because F. luteum seems to be common in Australasia. Fusicoccum luteum initially was described from Actinidia, Malus and Pyrus in New Zealand (Pennycook and Samuels 1985Go) and subsequently also from avocado (Hartill 1991Go).

Sequence variation was observed among isolates of clade VI (Fusicoccum sp.) and clade VII (B. dothidea) that was not phylogenetically informative. Among the three isolates identified in clade VI one isolate had sequence variation only in the ß-tubulin region. In clade VII the three isolates from mango grouped together based on two variable bases in the ITS region. In both cases these variable characters thus were found only in one of the two sequenced regions. Additional data and a larger number of isolates are required to determine the extent of variation and its phylogenetic relevance to populations of the above clades.

The many misidentifications of botryosphaeriaceous fungi from mango illustrate aptly how confusing morphological characterization of these fungi has been. This problem resulted from the fact that continuous characters for these species overlap. The confusion was amplified by differences in morphological characters from nature and from culture (Slippers et al 2004Go, Johnson 1992Go). Furthermore, conidial septation and color, which have been used to characterize species, was not always consistent. Conidia tend to age only after discharge from the pycnidia and their color and septation changes with age.

This study provides a basis on which future identifications of Botryosphaeria and its anamorphs from mango can be made. The combination of molecular data and average conidial size and shape, as well as cultural characteristics, has been used successfully here to identify these fungi from mango. Correct identifications of these pathogens are crucial due to increased quarantine requirements. These data also will help studies for a better understanding of the epidemiology of the different fungal species.


    ACKNOWLEDGMENTS
 
We thank the National Research Foundation (NRF), Mellon Foundation, members of the Tree Pathology Co-operative Programme (TPCP) and the THRIP initiative of the Department of Trade and Industry (DTI), South Africa for financial assistance. We also thank Mr AW Cooke of the Department of Primary Industries, Queensland for technical support, and the Australian Centre for International Agricultural Research ACIAR project PHT/1984/044 for financial support for the contributions by GI Johnson to this paper.


    FOOTNOTES
 
Accepted for publication August 18, 2004.

1 Corresponding author. E-mail: bernard.slippers{at}fabi.up.ac.za


    LITERATURE CITED
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 KEY TO BOTRYOSPHAERIA SPP....
 DISCUSSION
 LITERATURE CITED
 
Brown EA, Britton KO. 1986. Botryosphaeria diseases of apple and peach in the Southern United States. Plant Dis 70:480–484.[CrossRef]

Cappellini RA, Ceponis MJ, Lightner GW. 1988. Disorders in Avocado, Mango, and Pineapple Shipments to the New York Market, 1972–1985. Plant Dis 72:270–273.

Crous PW, Palm ME. 1999. Reassessment of the anamorph genera Botryodiplodia, Dothiorella and Fusicoccum. Sydowia 52:167–175.

Darvas JM. 1991. Dothiorella dominicana, a new mango pathogen in South Africa. Phytophylactica 23:295–298.

Denman S, Crous PW, Taylor JE, Kang JC, Pascoe I, Wingfield MJ. 2000. An overview of the taxonomic history of Botryosphaeria and a re-evaluation of its anamorphs based on morphology and ITS rDNA phylogeny. Stud Mycol 45:129–140.

———, ———, Groenewald JZ, Slippers B, Wingfield BD, Wingfield MJ. 2003. Circumscription of Botryosphaeria species associated with Proteaceae based on morphology and DNA sequence data. Mycologia 95:294–307.[Abstract/Free Full Text]

Eriksson T. 1998. Autodecay 4.0 (program distributed by the author). Department of Botany, Stockholm University, Stockholm.

Farris JS, Kallersjo M, Kluge AG, Bult C. 1995. Testing significance of incongruence. Cladistics 10:315–319.[CrossRef]

Felsenstein J. 1985. Confidence intervals on phylogenetics: an approach using bootstrap. Evolution 39:783–791.[CrossRef]

Glass NL, Donaldson GC. 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous Ascomycetes. Appl Environ Microbiol 61:1323–1330.[Abstract/Free Full Text]

Hartill WFT. 1991. Postharvest diseases of avocado fruit in New Zealand. NZ J Crop Hort Sci 19:297–304.

Hillis DM, Huelsenbeck JP. 1992. Signal, noise, and reliability in molecular phylogenetic analyses. J Hered 83: 189–195.[Abstract/Free Full Text]

Huelsenbeck JP, Bull JJ, Cunningham CW. 1996. Combining data in phylogenetic analysis. TREE 11:152–158.

Jacobs KA, Rehner SA. 1998. Comparison of cultural and morphological characters and ITS sequences in anamorphs of Botryosphaeria and related taxa. Mycologia 90:601–610.[CrossRef]

Johnson GI. 1992. Biology and control of stem-end rot pathogens of mango. [Doctoral dissertation]. Queensland, Australia: University of Queensland. 265 p.

———, Cooke AW, Mead AJ, Wells IA. 1991a. Stem-end rot of mango in Australia: cause and control. Acta Hort 291:288–295.

———, Mead AJ, Cooke AW, Dean JR. 1991b. Mango stem-end rot pathogens—infection levels between flowering and harvest. Ann Appl Biol 119:465–473.[CrossRef]

———, ———, ———, ———. 1992. Mango stem end rot pathogens—fruit infection by endophytic colonisation of the inflorescence and pedicel. Ann Appl Biol 120: 225–234.[CrossRef]

Lonsdale JH. 1992. Etiology and control of some mango blossom diseases in Transvaal. [Master’s thesis]. Pretoria, South Africa: University of Pretoria. 103 p.

McGlohon NE. 1982. Botryosphaeria dothidea—where will it stop? Plant Dis 66:1202–1203.

Mitra SK, Baldwin EA. 1997. Mango. In: Mitra MA, ed. Post-harvest physiology and storage of tropical and subtropical fruits. Oxon, United Kingdom: CAB International. p 85–122.

Natrass RM. 1933. A new species of Hendersonula (H. toruloidea) on deciduous trees in Egypt. Trans Br Mycol Soc 18:189–198.

Pennycook SR, Samuels GJ. 1985. Botryosphaeria and Fusicoccum species associated with ripe fruit rot of Actinidia deliciosa (Kiwifruit) in New Zealand. Mycotaxon 24: 445–458.

Petrak F, Ciferri R. 1930. Fungi Dominicani I. Ann Mycol 28:411.

Petrak F, Sydow P. 1927. Die Gattung der Pyrenomyzeten, Sphaeropsideen und Melanconieen. Repert Spec Nov Regni Veg Beihefte 42:1–551.

Petrak F. 1922. Beiträge zur Kentnis der Pilzflora der südlichen Alpenländer und Norditaliens. Ann Mycol 20: 126–159.

Phillips AJL, Fonseca F, Povoa V, Castilho R, Nolasco G. 2002. A reassessment of the anamorphic fungus Fusicoccum luteum and description of its teleomorph Botryosphaeria lutea sp. nov. Sydowia 54:59–77.

Prakash OM, Srivastava KC. 1987. Mango diseases and their management. A world review. New Delhi, India: Today and Tomorrow’s Printers and Publishers. 180 p.

Prusky D. 1991. Mango diseases: an overview. Acta Hort 291: 279–287.

Punithalingam E, Waterston JM. 1970. Hendersonula toruloidea. CMI descriptions of pathogenic fungi and bacteria, No. 274. Kew, Surrey, England: Commonwealth Mycological Institute. 2 p.

Ramos LJ, Lara SP, McMillan Jr RT, Narayanan KR. 1991. Tip dieback of mango (Mangifera indica) caused by Botryosphaeria ribis. Plant Dis 75:315–318.

Raeder U, Broda P. 1985. Rapid preparation of DNA from filamentous fungi. Lett Appl Microbiol 1:17–20.

Roux C. 1993. Nattrassia mangiferae, a fungus causing several diseases of mango. SA Mango Growers’ Yearbook 13:93–96.

Saccardo PA. 1882. Sylloge fungorum omnium hucusque cognitorum 1:1–768.

Saccardo PA. 1915. Nuovo giornale botanico italiano 22:53.

Samuels GJ, Singh B. 1986. Botryosphaeria xanthocephala, cause of stem canker in pigeon pea. Trans Br Mycol Soc 86:295–299.

Sangchote S. 1991. Botryodiplodia stem-end rot of mango and its control. Acta Hort 291:296–303.

Shoemaker RA. 1964. Conidial states of some Botryosphaeria species on Vitis and Quercus. Can J Bot 42:1297–1301.[CrossRef]

Slippers B, Crous PW, Denman S, Coutinho TA, Wingfield BD, Wingfield MJ. 2004. Combined multiple gene genealogies and phenotypic characters differentiate several species previously identified as Botryosphaeria dothidea. Mycologia 96:83–101.[Abstract/Free Full Text]

Smith H, Crous PW, Wingfield MJ, Coutinho TA, Wingfield BD. 2001. Botryosphaeria eucalyptorum sp. nov., a new species in the B. dothidea-complex on Eucalyptus in South Africa. Mycologia 93:277–284.[CrossRef]

Smith DR, Stanosz GR. 2001. Molecular and morphological differentiation of Botryosphaeria dothidea (anamorph Fusicoccum aesculi) from some other fungi with Fusicoccum anamorphs. Mycologia 93:505–515.[CrossRef]

Stevens NE. 1926. Occurrence of the currant cane blight fungus on numerous hosts in the southern states. Mycologia 18:278–282.[CrossRef]

Sutton BC, Davison EM. 1983. Three stromatic Coelomycetes from Western Australia. Trans Br Mycol Soc 81: 291–301.

Sutton BC, Dyko BJ. 1989. Revision of Hendersonula. Mycol Res 93:466–488.[CrossRef]

Swofford DL. 1999. PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods). Version 4. Sunderland, Massachusetts: Sinauer Associates.

Sydow H, Sydow P, Butler EJ. 1916. Fungi Indiae Orientalis. V. Ann Mycol 14:177–220.

von Arx JA, Müller E. 1954. Die Gattungen der amerosporen Pyrenomyceten. Beitr Kryptogamenfl Schweiz 11(1):1–434.

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Snisky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego: Academic Press. p 315–322.

Young HE. 1948. Hendersonula agathi n. sp., the cause of leaf cast of Kauri pine in Queensland. Queensland J Agric Sci 5:9–12.

Zhou S, Stanosz GR. 2001. Relationships among Botryosphaeria species and associated anamorphic fungi inferred from the analyses of ITS and 5.8S rDNA sequences. Mycologia 93:516–527.[CrossRef]




This article has been cited by other articles:


Home page
SIMHome page
P. W. Crous, B. Slippers, M. J. Wingfield, J. Rheeder, W. F.O. Marasas, A. J.L. Philips, A. Alves, T. Burgess, P. Barber, and J. Z. Groenewald
Phylogenetic lineages in the Botryosphaeriaceae.
Stud Mycol, January 1, 2006; 55: 235 - 253.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Slippers, B.
Right arrow Articles by Wingfield, M. J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Slippers, B.
Right arrow Articles by Wingfield, M. J.
Agricola
Right arrow Articles by Slippers, B.
Right arrow Articles by Wingfield, M. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS