Mycologia
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

DOI: 10.3852/mycologia.97.1.139
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Estrada-Torres, A.
Right arrow Articles by Keller, H. W.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Estrada-Torres, A.
Right arrow Articles by Keller, H. W.
Agricola
Right arrow Articles by Estrada-Torres, A.
Right arrow Articles by Keller, H. W.
Mycologia, 97(1), 2005, pp. 139-149.
© 2005 by The Mycological Society of America

The myxomycete genus Schenella: morphological and DNA sequence evidence for synonymy with the gasteromycete genus Pyrenogaster


Arturo Estrada-Torres

     Centro de Investigaciones en Ciencias Biológicas, Universidad Autónoma de Tlaxcala, Apdo. Postal 183. Tlaxcala 90000, México

Thomas W. Gaither

     Department of Biology, Slippery Rock University, Slippery Rock, Pennsylvania 16507-1325

Dennis L. Miller 1

     Department of Molecular and Cell Biology F03.1, University of Texas at Dallas, Richardson, Texas 75080

Carlos Lado

     Real Jardín Botánico, CSIC. Plaza de Murillo 2, 28014 Madrid, España

Harold W. Keller

     Department of Biology, Central Missouri State University, Warrensburg, Missouri 64093

    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 

The genus Schenella has proven difficult to classify since its description as a new genus in 1911. Macbride placed it with the Myxomycetes but it was unclear with which myxomycete, if any, it should be grouped. Recent identification of abundant samples of Schenella has aided a re-evaluation of its classification as a myxomycete. Morphological evidence based on light and scanning electron microscopy of recently collected specimens and on the type specimen of Macbride suggested that it might be synonymous with the gasteromycete Pyrenogaster. Analysis of DNA sequences from freshly isolated samples indicates that the genus Schenella is related closely to an anciently diverged, monophyletic group of fungi that includes several gasteromycete genera, among them Geastrum, Sphaerobolus and Pseudocolus. Comparisons of the morphology and DNA sequences of authentically identified specimens of Pyrenogaster atrogleba indicate that it is synonymous with Schenella simplex. The nomenclatural implications of this discovery are discussed.

Key words: Eumycetozoa, gasteromycete, molecular systematics, Myxomycetes, plasmodial slime molds, Pyrenogaster, Schenella


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Schenella simplex was described and illustrated as a new genus and species by Thomas H. Macbride (1911)Go. A single collection gathered in Aug 1903 on a decaying pine log in Yosemite Valley, California, was designated as the holotype. Macbride expressed doubt about this taxon in the first sentence of his brief paper: "This following description and accompanying figures are submitted to mycologists partly for the sake of eliciting information." Macbride further noted that, "If a slime-mould, the species is referable to the family Dianemaceae and is akin to those in which the capillitial threads pass from side to side of the fructification, attached at each end." This unique combination of characters—aethalioid fructifications, simple capillitial threads twisted together to form vertical columns attached to the outer peridium and at the base of the fructification along with tiny, smooth, spherical spores, 5–6 µm diam—were the stated hallmarks of this enigmatic taxon. The status of Schenella simplex as a myxomycete was so doubtful that Macbride omitted the taxon from his 1922 monograph (Macbride 1922Go), nor was it included in the Lister monograph (Lister 1925Go).

In the 1934 monograph by Macbride and Martin (1934)Go Schenella simplex again was included. Commentary after the species description again casts doubt on the status of this taxon: "A very curious form, of somewhat doubtful affinities and placed in the Stemonitaceae on the basis of the dark violet brown spores and the dark capillitium. There is no suggestion of columellae in the pillar-like columns. To the naked eye it suggests an amaurochaete." Spores were described as "rather coarsely tuberculate" and not smooth.

Hagelstein (1944)Go made reference to Schenella simplex in the Amaurochaetaceae but again expressed doubt about its status: ". . . might appropriately be placed in this family if conclusively proven to be a form of Mycetozoa. The original description and figures are not impressive, and clearly indicate the author was uncertain." Schenella was not included in his key to the genera.

Martin (1949)Go included a note about Schenella in the Stemonitaceae that, "if it is a myxomycete, (it) would be placed in this family close to Amaurochaete." A dichotomous key to 10 genera in the family fails to include Schenella. Martin (1961)Go described a second species of Schenella, S. microspora, after reexamination of the type of S. simplex. He concluded that Schenella was a valid genus in the Stemonitaceae, closely allied to Amaurochaete. Martin re-interpreted the morphology of this taxon as a pseudoaethalium, not an aethalium, with the sporangia arranged vertically much as in Dictydiaethalium. Each column (sporangium) appeared to have a distinct top with an individual peridium and a coiled, twisted mass of pseudocapillitial threads attached also at the base of the fructification. There was no trace of a columella. The capillitial system consisted of a bundle of threads within each sporangium. Martin (1961)Go emended the generic and species description, emphasizing the dark capillitium and dark spores as the salient morphological characters for assignment to the Stemonitaceae close to Amaurochaete. Spore diameter of S. simplex was given as 5–6 µm and for S. microspora 3.5–4(4.5) µm. Martin (1961)Go also noted that spores were small for a myxomycete but no smaller than other well known species. This statement is supported by examples such as Stemonitis microsperma B. Ing, and S. smithii Macbr., with the smallest spore diameters known in the Myxomycetes (Martin and Alexopoulos 1969Go).

Nannenga-Bremekamp (1967)Go used capillitial characteristics to transfer Schenella from the Stemonitaceae to its own monogeneric family, the Schenellaceae. This transfer was based exclusively on the literature because no specimens were examined.

The description of a second species in the genus, Schenella microspora, by Martin (1961)Go seems to have convinced other authors as to its identity as a myxomycete and recognition of a separate family, Schenellaceae (Martin and Alexopolous 1969, Nannenga-Bremekamp 1974Go, Farr 1976Go, Martin et al 1983Go, Hawksworth et al 1995Go).

Rammeloo (1985)Go examined spores of the type specimen of S. simplex using scanning electron microscopy, expressing doubt that the taxon was a myxomycete because the spores possessed a pore similar to that of some taxa in the fungal order Agaricales. One field collection from Mexico more recently was identified as Schenella simplex and compared with the type of S. simplex. Rodríguez-Palma and Estrada-Torres (1996)Go collected this specimen in the Abies religiosa forest in Malintzi National Park, Tlaxcala, México.

This paper reports comparisons of additional specimens from Cofre de Perote National Park, Veracruz, México, identified as S. simplex, previously known only from its type locality in California. Evidence from light microscopy and scanning electron microscopy indicates that the Mexican specimens are identical to the S. simplex type. Morphological data, as well as DNA sequence evidence from the Mexican specimens, also indicate that S. simplex is related to an anciently diverged group of gasteromycete fungi and should not be classified as a myxomycete. Further, morphological characterization indicates that S. simplex is synonymous with the gasteromycete fungus, Pyrenogaster atrogleba (Zeller) L.S. Domínguez & Castellano. In support of this, DNA sequences obtained from authentically identified P. atrogleba specimens are identical to DNA sequences from the Mexican specimens of S. simplex.

Preliminary work on the status of Schenella has been published as abstracts (Gaither and Keller 1997Go, Estrada-Torres et al 2002Go, Gaither and Keller 2002Go).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Recent field collections of S. simplex were examined from two Mexican states, Tlaxcala and Veracruz. Representative specimens are deposited in the TLXM herbarium with some duplicates at MA-Fungi. Specimens were washed with alcohol and distilled water to eliminate as many spores as possible. Freehand transverse sections were made of peridial fragments for microscopic examination and then rinsed and stained with a 1% aqueous solution of methylene blue following the technique described by Largent et al (1977)Go. Permanent slides of these sections or of complete fruiting bodies were made in Hoyer’s medium. Microscopic examination was made with a light microscope equipped with differential interference contrast imaging (Nomarski optics) or with bright field light microscopy. Fruiting bodies were mounted in either distilled water, clear lactophenol or Hoyer’s medium. Selected specimens were photographed under 600x or 1000x under the oil immersion lens using either a Nikon E-600 microscope or an Olympus PM10 photomicrographic system. All SEM preparations used the critical point drying technique. SEM images were recorded on Polaroid 55 film using either of these SEMs: AMRAY 1200 at 35 kV, a JEOL JSM-35C, or a JEOL T-300 at 15 kV. Color standards followed the ISCC-NBS Color Name Charts Illustrated with Centroid Colors (Anon. 1976).

Spore germination was observed using a suspension of spores in sterile distilled water placed in a depression microscope slide. Hanging drop spore preparations using sealed cover glasses over a depression microscope slide were observed periodically up to 1 wk. Spore cultures were prepared by spreading spores uniformly using a sterile glass rod with 0.1 ml aliquots of a spore suspension on the surface of these culture media: 2% water agar, potato-dextrose agar and a modification of Melin & Norkrans medium for ectomycorrhizal fungi (Marx 1969Go).

Specimens examined.— – Schenella simplex T.H. Macbr., Type specimen. USA. CALIFORNIA: Yosemite Valley, on a decaying pine log, Aug 1903, T.H. Macbride (HOLOTY PE, BPI839197). MÉXICO. TLAXCALA: Huamantla municipality, Malintzi National Park, cañada central, 19°14'29''N, 97°59'38''W, 3300 m, 13 Apr 1990, on leaves of Alnus sp. in Abies-Pinus forest, A. Estrada-Torres & M. Rodríguez-Palma, TLXM sub RP-1775. VERACRUZ: Perote municipality, Cofre de Perote National Park, 19°31'11''N, 97°09'28''W, 3390 m, 9 Mar 1998, on trunks, needles and wood of Abies religiosa, and bryophytes, A. Estrada-Torres, C. Lado, M. Rodríguez & A. Varela, TLXM sub ET 4029, 4030, 4031, 4032, 4033, 4034, 4035, 4036; ibídem, 1 Mar 2001, on bryophytes, A. Estrada-Torres & M. Ramírez-Ortega, TLXM sub ET 7511, 7512. Pyrenogaster atrogleba (Zeller) L.S. Domínguez & Castellano: ITALY: Ravenna, under Pinus pinea, 18 Dec 1993, leg. A. Randi, MA-Fungi 32070. MÉXICO. MORE-LOS: Lagunas de Zempoala National Park, under Abies, 12 Oct 1965, ENCB sub G. Guzman 4946 (as Radiigera atrogleba Zeller). TLAXCALA: Huamantla municipality, Malintzi National Park, cañada central, 19°14'29''N, 97°59'38''W, 3300 m, under Abies religiosa, 9 Mar 1990, TLXM sub A. Kong Luz 1338 (as Radiigera atrogleba). USA. WASHINGTON: Pend Orielle County, USA. Pend Orielle County Park, along U.S. 2, under Pseudotsuga menziesii, and other conifers, 6 Oct 2000, M. Castellano, collector, collection number Trappe 25561 (OSC80968.

Molecular techniques.— – DNA isolation.. Total cellular DNA was released from the Mexican S. simplex specimens by suspending a small portion of the material in BEST (0.1% bovine serum albumin, 60 mM EDTA, 300 mM sucrose, 20 mM Tris-HCL, pH 7.4) and disrupting membranes by the addition of sodium dodecyl sulfate (SDS) to a concentration of 2%. The lysate was centrifuged at 8000 x g 10 min at 4 C. After centrifugation the supernatant was extracted with an equal volume of phenol and then with an equal volume of chloroform. Total nucleic acids were precipitated by the addition of 0.2 volumes of 3M sodium acetate, pH 7.8 and 3 volumes of 95% ethanol. Nucleic acids were pelleted by centrifugation at 12 000 x g 10 min at 4 C. After decanting the supernatant ethanol, the pellet was dried in vacuo and resuspended in TE buffer (10 mM Tris-HCl, pH 8; 1 mM EDTA).

Oligonucleotide primers.. Primers used for the polymerase chain reaction (PCR), and DNA sequence analysis were synthesized commercially (Sigma-Genosys).

Mitochondrial SSU primers. Mt SSU Bam HI 5' CGGGATCCAGCAGCCGCGGTAA 3'

Mt SSU PstI 5' AACTGCAGTCGAATTAAACCACAT 3'

Fungal 5' mtSSU 5' CTGGTGCCAGAAGACTCGGT 3'

Fungal 3' mtSSU 5' GTACTCACAAGGCGGAATGG 3'

Nuclear SSU primers. Nuc SSU BamHI 5' CGGGATCCAGCACCCGCGGTAA 3'

Nuc SSU EcoRI 5' GGAATTCGTCAAATTAAGCCGCAGG 3'

Polymerase chain reaction.. Total nucleic acids were resuspended in TE (10mM Tris-HCl, pH 8; 1 mM EDTA), and RNA was removed by digestion with DNAase-free RNAase A (Sigma Chemical Co.) at 37 C for 30 min. The DNA was used as template for PCR (Saiki et al 1988Go) with the set of either SSU mitochondrial primers or the SSU nuclear primers to amplify the core region of the small subunit ribosomal RNA from the mitochondria or the nucleus respectively. The amplification was performed in 10 mM Tris-HCl, pH 8.3; 50 mM KCl; 2.5 mM MgCl2; 200 µM deoxynucleotide triphosphates; 2.5 units Taq DNA polymerase (Fisher Biotech). The thermal cycle regimen consisted of 94 C for 1 min, 55 C for 2 min and 72 C for 2 min for 35 cycles. During the final cycle an extension of 10 min at 72 C was performed and the reaction products were slowly cooled to 4 C for complete annealing.

Recovery of PCR amplification products.. PCR amplification products were separated from the PCR primers by electrophoresis in 1% agarose-TAE (40 mM Tris-acetate, pH 7.9, 1 mM EDTA) gels. The amplification products were excised from the gels and removed from the agarose by binding to glassmilk (GENECLEAN II kit, BIO101).

Sequence analysis.. DNA amplification products recovered from agarose were sequenced directly. Both strands of the amplification products were sequenced individually using each of the PCR primers. Sequences of the amplification products were determined using the cycle sequencing, dye-labeled terminator procedure (ABI PRISM, Applied Biosystems). Thirteen pmol of primer in 4 µL of water was extended on a template of 80 ng of PCR amplification product in 4 µL of water using ampliTaq DNA Polymerase FS in the presence of Big Dye terminator mix. Thermocycling conditions were 90 C for 30 s, 50 C for 15 s and 60 C for 3 min. Sequence data were analyzed using the MicroGenie sequence analysis package (Queen and Korn 1984Go).

Phylogenetic analysis.. DNA sequences were aligned initially using the multiple alignment algorithm of MicroGenie sequence software (Queen and Korn 1984Go) and then manually adjusted. Regions of length variation were omitted in the alignment. Maximum parsimony trees were produced from alignments using the DNAPARS algorithm from the PHYLIP package, version 3.57c (Felsenstein 1995Go). Distance matrices were produced from pairwise comparisons of aligned sequences or by using the maximum likelihood (ML) option of the DNADIST algorithm of PHYLIP on multiple alignments. Trees were produced from these matrices using the FITCH algorithm of PHYLIP. Bootstrap values were determined using the SEQBOOT algorithm of PHYLIP.

Nucleotide sequence accession numbers.. The mtDNA and nuclear DNA core SSU rRNA sequences from S. simplex have been submitted to GenBank under accession numbers AY573059 [GenBank] and AY573060 [GenBank] respectively.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Description of specimens identified as Schenella simplex from México (FIGS. 1Go–16Go).— – Fruiting bodies pulvinate, sessile, slightly adhering to the substratum, spreading over 1–5 cm, grayish (265. med. Gy), formed by cylindrical cavities of 5–6 x 0.5 mm, concrescent, closely compacted in a palisade layer, divided by peridial plates (FIGS. 14, 15Go). Hypothallus lacking, not observed on the substratum. Peridium thick, evanescent or persistent at the apex when remaining as a cap, grayish, opaque, brown by transmitted light, formed by irregular cells, branched and intermixed with hyphae; peridial plates limiting the cylindrical cavities formed by a compact system of colorless hyphae interwoven with brown and granular hyphae (conductive hyphae) when seen with light microscopy, 2.4–4 µm diam; peridium persistent and coriaceous at their base, areolate, olive-brown (95. m. Ol Br-96. d. Ol Br) by transmitted light. A stratification of four different layers of cells can be observed (FIG. 1Go), the external 10–15 µm thick, formed by crystalline deposits (birefringent by polarized light) and with some emergent fibulate hyphae, a second compacted stratum of 10–15 µm thick, formed by irregular cells (FIGS. 3, 4Go), a third stratum 30–35 µm thick, formed by irregular or subglobose cells, 8–24 x 4–9.6 µm, interwoven, and finally a compact stratum, 5–10 µm thick, formed by hyphae with irregular and branched cells (FIGS. 3, 4Go); jointly the layers form a pseudoparenchymatous tissue easy to observe by transverse cuts with LM (FIG. 1Go) which freely absorb methylene blue. The cellular nature of the peridium can be observed by SEM (FIG. 6Go). Capillitium composed of elastic, brownish gray (63. l. brGy-64. br Gray), bright threads in groups of helical filaments (FIG. 8Go) that occupy almost all of the cavity of the peridiole, and joined to the extremities, elastic at maturity and procumbent; threads single (FIG. 9Go) or branched at the ends, smooth, bright, grayish yellow (91. d. gy. Y) to olive brown (95. m. Ol Br) by transmitted light, 2.4–4.8 µm diam, thick-walled (up to 1.5 µm; FIG. 5Go), occasionally septate (FIG. 16Go), arising from irregular and branched cells of the inner layer of the peridium (FIG. 5Go). Spores free, dark brown (62. d. gy. Br-65. br Black) in mass, dark yellowish brown (78. d. y Br-75. deep y Br) to dark olive brown (96. d. Ol Br) by transmitted light, subglobose to slightly elliptical, 5.6–6.4 x 4.4–5.6 µm, thick walled, 1.0–1.5 µm, paler at the end with a pore or a scar, the pore circular and depressed, the ornamentation consists of dense, irregular warts, confluent into a subreticulum, fused and smaller toward the pore or scar forming radial crests as seen with SEM (FIGS. 10–13Go). Based on these characteristics, these specimens were tentatively identified as S. simplex.



View larger version (139K):
[in this window]
[in a new window]
 
FIGS. 1–5. Schenella simplex Mexican specimen (ET-4036). 1. (top panel) Pseudoparenchymatous tissue with a stratification of different layers of cells. 2. (middle left) Middle stratum of the peridium with globose cells. 3–4. (middle right, lower left) Irregular cells of the peridium. 5. (lower right) Capillitial thread branched at the end. Scale bars = 10.0 µm.

 


View larger version (165K):
[in this window]
[in a new window]
 
FIGS. 14–19. Schenella simplex Mexican specimen (ET-4034) and holotype (BPI 839197). 14–16 Mexican specimen (ET-4034). 14. (upper left) Vertical wall of cylindrical chamber (peridiole) packed with spores and capillitial threads. 15. (upper right) Spore mass retaining shape of vertical chamber. Note spores embedded in gelatinous material. 16. (middle left) Spores adhering to capillitial thread. Note collapsed thread and possible septum (arrow). 17–19 Holotype (BPI 839197). 17. (middle right) Peridial fragment with underlying entangled mass of long unbranched capillitial threads intermingled with spores. 18. (lower left) Smooth capillitial threads. Spore with basal scars (arrow). 19. (lower right) Spore with basal scar. Compare spore with Figs. 12, 13, and Fig. 19 in Domínguez de Toledo and Castellano (1996)Go. Scale bars: 15–18 = 10.0 µm, 19 = 1.0 µm.

 


View larger version (154K):
[in this window]
[in a new window]
 
FIGS. 6–13. Schenella simplex Mexican specimens. 6–9. Specimen ET-4031. 6. (upper left) Peridium. 7. (upper right) Spores interwoven with hyphae. 8. (second row left) Peridiole with capillitial threads. 9. (second row right) Capillitial threads and spores. 10–11. (third row) Spores of the specimen ET-4036. 12–13. (bottom row) Spores of the specimen ET-4031. 13. (bottom right) Spore with basal scar. Scale bars: 6–9 = 10 µm, 10 = 5 µm, 11–13 = 1 µm.

 
Germination and culture.— – Spore germination or production of myxamoebae or hyphal filaments were not observed in water or in selected media.

Commentary.— – The microscopic characters are reminiscent in color, form and habit of some species of myxomycetes (Amaurochaete), but the spore ornamentation and the scar, which is discernible by LM (Rammeloo 1985Go) and clearly visible by SEM, have not been seen in any myxomycete.

Analysis of Schenella simplex type specimen.— – To confirm that the Mexican specimens were S. simplex, parallel analyses of the type specimen for Schenella simplex were done with light and scanning electron microscopy.

Commentary on the Schenella simplex holotype.— – The type is represented by ample material with the following morphological features. Re-examination of the holotype of S. simplex with LM and SEM showed the vertical chambers (peridioles) packed with spores and coiled, twisted capillitial threads. Peridial fragments are scattered among the capillitial threads but no longer form an outer crust (intact glebal layers) as indicated in the original species description (FIG. 17Go). It is understandable that the holotype, now close to 100 y old, has undergone additional fragmentation. The combination of the morphology of the capillitial threads and spores separates this taxon from all other myxomycete species. The tubular threads and spore mass appear black in mass. The capillitial threads are unbranched, thick walled, lack ornamentation and have occasional septations (FIG. 18Go). These features alone would eliminate S. simplex as a myxomycete. Spore morphology when compared to typical myxomycete spores appears quite different. The small, thick-walled spores with elliptical shapes when observed in side view are different from all other myxomycete spores. Observations with SEM clearly demonstrate the morphological features of a basidiospore. The apiculate basal area represents the former attachment to the basidium. Generally in SEM preparations the distal polar view is directed upward and the apiculate view downward, but a few spores with the basal scar usually can be found. Unlike typical myxomycete spores, Schenella spores do not collapse when dehydrated and the size, 3.5 µm, extends beyond the smallest known range for myxomycete spores. The basal scar is recessed in the center with a smooth, raised margin, distinctly different from the rest of the surface ornamentation (FIG. 19Go). Capillitial threads and spore morphology are identical to the Mexican specimens identified as S. simplex.

The most obvious morphological characters of the genus Schenella were studied. In all cases the presence of a cellular peridium (pseudoparenchyma) (FIGS. 1, 2Go), a hyphal network with clamp connections in the external layers of the peridium and spores with a scar or pore (FIGS. 12, 13Go) similar to that illustrated by Rammeloo (1985)Go were confirmed. This combination of characters belongs only to some groups of fungi in the strictest sense of the word and prompts us to remove Schenella from the myxomycetes. The presence of fibula would fit this genus in the Basidiomycetes, and the existence of a capillitium would put it in the Gasteromycetes sensu lato.

Sequence analysis of DNA extracted from a Mexican Schenella simplex sample.— – To test the conclusion, based on morphological features of the Mexican and type specimen, that Schenella is a gasteromycete fungus, DNA was isolated from a Mexican specimen (ET-7512) and used as the template in PCR experiments. Primer pairs were used that specifically amplified core regions of myxomycete small subunit ribosomal RNA (SSU rRNA) genes from nuclear chromosomal DNA and mitochondrial (mt) DNA (Miller pers comm). While no amplification product was obtained for the mitochondrial primer pair, a 639 base pair amplification product consistent with a fungal nuclear template, but inconsistent with a mitochondrial or bacterial template (Miller pers comm), was obtained with the nuclear primer pair. Sequence analysis of the amplification product obtained with the nuclear primer pair revealed a sequence similar to those found in an anciently diverged, monophyletic group of fungi that includes Geastrum, Sphaerobolus and Pseudocolous (Hibbett et al 1997Go) but is quite different from sequences of myxomycetes. The sequence was most similar to the nuclear SSU rDNA sequence of Geastrum saccatum with 96.4% sequence identity. A primer pair designed to amplify fungal mitochondrial small subunit ribosomal RNA sequences with PCR was used to amplify sequences from Schenella nucleic acids. An amplification product of the size predicted (383 base pairs) for fungal mitochondrial rDNA sequences was obtained. Sequence analysis of the mitochondrial amplification product revealed sequences similar to the mitochondrial DNA of the same monophyletic fungal group. Again the closest match was with Geastrum saccatum with 88.3% sequence identity. Phylogenetic analysis of both nuclear and mitochondrial DNA sequences amplified from Schenella nucleic acids indicates that Schenella should be grouped with these fungi and that it is most closely related to Geastrum (FIG. 20Go).



View larger version (10K):
[in this window]
[in a new window]
 
FIG. 20. Phylogeny of the monophyletic fungal group including S. simplex. The mtDNA sequences of the six anciently diverged, monophyletic fungi grouped by Hibbett et al (1997)Go with a bootstrap frequency of 100% (Sphaerobolus stellatus, Geastrum saccatum, Pseudocolus fusiformis, Gomphus floccosus, Ramaria stricta, and Clavariadelphus pistillaris) were aligned with the analogous mtDNA sequence from S. simplex. Tree topology was determined using maximum parsimony analysis (DNAPARS) of the mitochondrial SSU rDNA core sequence alignments. Numbers on the branches indicate the branch length in terms of the minimum number of base substitutions between nodes on the single most parsimonious tree. Numbers by the nodes (in italics) indicate the bootstrap frequencies.

 
Morphological evidence that Schenella simplex is synonymous with Pyrenogaster atrogleba.— – The fruiting body, with subcylindrical compartments arranged as palisades and filled with capillitium and spores originally perceived as sporocarps or sporangia, are the most distinctive features of this taxon. This type of morphology is known only from one hypogeous genus of Gasteromycetes, Pyrenogaster and is termed a peridiole.

Pyrenogaster was described in France by Malençon and Riousset (1977)Go as P. pityophilus and was considered to be a monospecific genus until Domínguez de Toledo and Castellano (1996)Go transferred Radiigera atrogleba Zeller to the genus under the name of P. atrogleba (Zeller) L.S. Domínguez & Castellano. The presence of a peridiole and the shape and size of the spores are the salient characters for this change.

Of the two known species of the genus, S. simplex specimens agree with the detailed description of P. atrogleba by Domínguez de Toledo and Castellano (1996)Go. This was confirmed by examination of P. atrogleba material kept at TLXM (Holmgren and Holmgren 1995Go). The characters that we observed in our material of S. simplex are the same as those described for P. atrogleba: the diameter (0.5 mm) and the arrangement of the peridiole with evanescent walls, and without evidence of adhesive material, the kind of capillitium, and the shape, size, color and type of ornamentation of the spores. The subcylindrical peridiola are arranged as palisades, with persistent caps of peridium at the apex, capillitium arranged in a helicoidal manner (FIG. 8Go), and subglobose to slightly elliptical spores (FIGS. 10, 11Go), with a circular pore and ornamented with irregular warts (FIGS. 12, 13Go). The illustrations by Domínguez de Toledo and Castellano (1996)Go (FIGS. 18, 19Go) of the spores by SEM also agree with those obtained in this study (FIGS. 11–13Go, 18, 19Go). Both of these authors and Malençon and Riousset (1977)Go described basidiomata with thick peridia for each species of Pyrenogaster. For P. atrogleba, Domínguez de Toledo and Castellano (1996)Go described a peridium made up of two layers, one mycelial layer 175–500 µm thick and another of stratified pseudoparenchyma approximately 45–100 µm thick. Of these layers, the field specimens had only the innermost stratum of the second layer (see FIG. 1Go) illustrated by Domínguez de Toledo and Castellano (1996Go, Fig. 1J) due to deterioration of the material. The characteristics of the strata observed are highlighted in the description. We have compared an exsiccatum of P. atrogleba from the same locality of the first record of S. simplex (Rodríguez-Palma and Estrada-Torres 1996Go), another from Morelos, México and another from Italy, all coincide with S. simplex in the characters mentioned above.

One character not pointed out by Domínguez de Toledo and Castellano (1996)Go is the presence of the irregular branched tips of the capillitial filaments (FIG. 5Go) that mingle with the cells of the internal layer of the peridium and are distinguishable from them by their thick walls. These already had been described, however, by Malençon and Riousset (1977)Go and illustrated for the other species of the genus. These also were present in the field collections of S. simplex.

The interpretation of S. simplex as a myxomycete could be due to the advanced maturity of the fungus and its fragmentation, which reveals structures of similar appearance to myxomycetes such as capillitium, dark spores and peridium. Malençon and Riousset (1977)Go noted the difficulty in identifying any very mature stages of the fungus. The appearance of this hypogeous fungus on the surface of logs, dead wood and bryophyte layers covering the ground is an enigma, perhaps explainable by the activities of some animal.

DNA sequence evidence that Schenella simplex is synonymous with Pyrenogaster atrogleba.— – To confirm the supposition that Schenella simplex is synonymous with Pyrenogaster atrogleba, DNA was isolated from authentically identified P. atrogleba specimens (Trappe 25561, OSC 80968) from M. Castellano and used as the template in PCR reactions with the nuclear mtSSU primers and, in a separate reaction, with the fungal mtSSU primers. Amplification products of a size identical to those produced from the Mexican Schenella simplex samples (639 and 383 base pairs from nuclear and mitochondrial primer pairs respectively) were obtained. These amplification products were isolated and sequenced. These sequences were compared with those obtained from the Mexican Schenella simplex specimen and found to be identical.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Taxonomy.— – Morphological and molecular evidence leads us to conclude that S. simplex and P. atrogleba are identical and should be considered synonymous. From a nomenclatural point of view, the genus Schenella is transferred from the Myxomycetes to the Gasteromycetes and given its priority (art. 11.3 International Code of Botanical Nomenclature) over Pyrenogaster, these synonyms and combinations are proposed:

Schenella T. Macbr., Mycologia 3(1):39. 1911

= Pyrenogaster Malençon & Riousset, Bull. Soc. Mycol. France 93: 289. 1977, syn. nov.

Generitypus: Schenella simplex T. Macbr., Mycologia 3(1):39. 1911.

Generitypus specimen: BPI 839197. USA. California, Yosemite Valley, Aug 1903, on a decaying pine log, T.H. Macbride.

Schenella simplex T. Macbr., Mycologia 3(1):39. 1911

= Radiigera atrogleba Zeller, Mycologia 36(6):634. 1944, syn. nov., {equiv} Pyrenogaster atrogleba (Zeller) L.S.

Domínguez & Castellano, Mycologia 88(5):866. 1996.

Typus.- BPI 839197. USA. California, Yosemite Valley, Aug 1903, on a decaying pine log, T.H. Macbride, holotypus.

Schenella pityophilus (Malençon & Riousset) Estrada & Lado, comb. nov.

{equiv} Pyrenogaster pityophilus Malençon & Riousset, Bull. Soc. Mycol. France 93:290. 1977 [basion.].

Typus.—MPU (in coll. G.J.L. Malençon). FRANCE: near Aigues-Mortes, Mar-May 1976, under Pinus pinea needles, L. Riousset, holotypus (Isotypus at OSC).

Schenella romana (Quadracia) Estrada & Lado, comb. nov.

{equiv} Radiigera romana Quadracia, Mycotaxon 58:336 (1996) [basion.]; {equiv} Pyrenogaster romana (Quadracia) Calonge, Bol. Soc. Micol. Madrid 22:108. 1997)

Typus—ROHB (1325 LQ). ITALY: Roma, Orto Botanico, 22 Jan 1922, under Cupressus sempervirens, L. Quadracia, holotypus.

The identity of S. microspora (G.W. Martin, Mycologia 53[1]: 29. 1961, BPI 839199, U.S.A.: CALIFORNIA, Big Basin State Park, San Mateo County, 26 August 1957, on fallen trunk of Sequoia sempervirens [Lamb.] Endl., G.W. Martin 6547) still has to be clarified. Schenella microspora was studied using LM and SEM, but these results will be published elsewhere. There are still some questions if this taxon is synonymous with P. atrogleba (Gaither and Keller 2002Go, Gaither and Keller 2003Go).

Spore germination.— – Further evidence of the fungal nature of Schenella might have been provided by germination of the spores from the Mexican specimens. Spores did not germinate in either media for ectomycorrhizal fungi (potato-dextrose agar or modified Melin & Norkrans medium) or on 2% water agar. Most ectomycorrhizal fungal species such as Pyrenogaster have a low percentage of germination on artificial laboratory media (Molina & Palmer 1982Go), although the use of active charcoal to remove inhibitors or the presence of some stimulators (living organisms or chemical substances) can greatly improve the success of these procedures (Fries 1977Go, Ali and Jackson 1989Go, Iwase 1991Go). It also is relevant that spores of truffle-like fungi, such as Pyrenogaster, seem to be activated by passage through the intestine of mycophagous animals (Fogel and Trappe 1978Go). These two observations might explain why Schenella spores were not germinated using the techniques described. Germination of Schenella spores using alternate techniques or media is the goal of future experiments.

Ecology.— – The basidiomata studied were found on diverse substrata such as trunks, needles and fallen branches of conifers or bryophyte layers growing on the ground. These habitats are typical of many species of myxomycetes. This hypogeous taxon apparently is dug up by an animal and transported to above ground sites so that its appearance on these substrata is accidental.

As with other hypogeous Gasteromycetes, S. simplex must be dug up and carried away to be eaten by small rodents, a fact that favors its dispersal as has been demonstrated for other species of hypogeous ectomycorrhizal fungi (Maser et al 1978Go, Malajczuk et al 1987Go, Trappe 1988Go). The abundance of fruiting bodies (in 400 m2 about 20 were observed) and the way some were found, on trunks more than 1 m above ground or on mounds covered with bryophytes, supports this hypothesis. Furthermore rodent feces occasionally were observed alongside fruiting body remains.

None of the field collections contained complete basidiomata and in the majority of cases they were composed of spore masses and capillitium. This can be reconciled with the differential use of the fruiting body by animals (Cork and Kenagy 1989Go). Rodents feed on the fleshy parts of the fungus such as the columella and external layers of the peridium. As the columella and probably other fleshy parts of the unripe fungus are consumed the fruiting body is inverted leaving the outer peridium against the substrate and the base of the peridiole in the upper part, exposing the capillitium. Because the capillitium is elastic, it gives the procumbent appearance of some myxomycetes such as Comatricha longa Peck or species of Amaurochaete.

The fact that animals dig up and consume the whole fruiting structure appears to be one of the reasons why, in spite of intense searching in one locality, it was found again only after 3 y. It also is interesting to note that all collections of S. simplex (including those identified as Radiigera atrogleba) from Tlaxcala and Veracruz were collected during the end of the dry season (March and April) (Tejeda-Martínez et al 1989Go), when most of the mushroom species had not yet fruited in this area, indicating a peculiar phenology of the species. Furthermore in 1998 the collection of specimens in Cofre de Perote, one of the most productive localities, coincided with the dry period which that year was aggravated by the effects of El Niño.

The distribution of S. simplex is wider than was once thought since it was reported as Radiigera atrogleba from southwestern Canada (British Columbia), from USA (California, Colorado, Idaho, Montana, Oregon, Utah and Washington), from México (Baja California Norte and Morelos), from Sweden and Italy (Zeller 1944Go, Guzmán 1971Go, Kers 1976Go, Ayala and Guzmán 1984Go, Domínguez de Toledo and Castellano 1996Go, Calonge 1997Go) and as S. simplex from USA (California) and México (Tlaxcala and Veracruz) (Macbride 1911Go, Rodríguez-Palma and Estrada-Torres 1996Go).

Considering the ectomycorrhizal character of most hypogeous species, this species appears to be exclusively associated with conifers of such diverse genera as Abies, Picea, Pinus, Pseudotsuga, Thuja and Tsuga, although Kers (1976)Go also cited it under Fraxinus excelsior.


    ACKNOWLEDGMENTS
 
We thank the curators of herbaria BPI, ENCB and OSC for the loan of specimens. This research project was financed in part by a grant to HWK from the National Science Foundation, Biotic Surveys and Inventories Program, award number DEB-0079058, and to AET and CL by the Spanish Government, through the grant REN2002–00445.


    FOOTNOTES
 
Accepted for publication August 20, 2004.

1 Corresponding author. E-mail: dmiller{at}utdallas.edu


    LITERATURE CITED
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Ali NA, Jackson RM. 1989. Stimulation of germination of spores of some ectomycorrhizal fungi by other micro-organisms. Mycol Res 93:182–186.

Anonymous. 1976. ISCC-NBS color-name charts illustrated with centroid colors. Washington, DC: Inter-Society Color Council, National Bureau of Standards. 4 p + 18 pl.

Ayala N, Guzmán G. 1984. Los hongos de la península de Baja California. I. Las especies conocidas. Bol Soc Mex Mic 19:73–91.

Calonge FD. 1997. Notes on the genera Pyrenogaster and Radiigera (Gasteromycetes). Bol Soc Micol Madrid 22: 105–112.

Cork SJ, Kenagy GJ. 1989. Nutritional value of a hypogeous fungus for a forest-dwelling ground squirrel. Ecology 70:577–586.[CrossRef]

Domínguez de Toledo LS, Castellano MA. 1996. A revision of the genus Radiigera and Pyrenogaster. Mycologia 88: 863–884.[CrossRef]

Estrada-Torres A, Gaither TW, Miller DL, Lado C, Keller HW. 2002. The myxomycete genus Schenella: morphological and molecular evidence for the gasteromycete genus Pyrenogaster. In: Rammeloo J, Bogaerts A, eds. Fourth International Congress on Systematics and Ecology of Myxomycetes, Abstracts. Scripta Bot Belg 22:5.

Farr ML. 1976. Myxomycetes. Flora Neotrop 16:1–304.

Felsenstein J. 1995. PHYLIP (Phylogeny Inference Package), version 3.57c, Department of Genetics, University of Washington, Seattle.

Fogel R, Trappe J. 1978. Fungal consumption (mycophagy) in small mammals. Northwest Science 52:1–31.

Fries N. 1977. Germination of Laccaria laccata spores in vitro. Mycologia 69:848–850.[CrossRef]

Gaither TW, Keller HW. 1997. The mystery remains: what is Schenella? Tex J Micros 28(2):44.

———, ———. 2002. Microscopic evidence supporting the cogeneric status of Schenella simplex and S. microspora. In: Rammeloo J, Bogaerts A, eds. Fourth International Congress on Systematics and Ecology of Myxomycetes, Abstracts. Scripta Bot Belg 22:34.

———, ———. 2003. Light and scanning electron microscopy of the myxomycete species Schenella microspora and S. simplex: Morphological evidence for a gastroid basidiomycete. Inoculum 54:21.

Guzmán G. 1971. Notas sobre los géneros Radiigera y Mesophelliopsis en México. Bol Soc Mex Mic 5:7–11.

Hagelstein R. 1944. The mycetozoa of North America. Mineola, New York. 306 p.

Hawksworth DL, Kirk PM, Sutton BC, Pegler DN. 1995. Ainsworth & Bisby’s Dictionary of the Fungi. 8th ed. New York: French & European Publications Inc. 615 p.

Hibbett DS, Pine EM, Langer E, Langer G, Donoghue MJ. 1997. Evolution of gilled mushrooms and puffballs inferred from ribosomal DNA sequences. Proc Natl Acad Sci USA 94:12002–12006.[Abstract/Free Full Text]

Holmgren PK, Holmgren NH. 1995. Additions to Index Herbariorum (Herbaria), Edition 8-Fourth Series. Taxon 44:251–266.

Iwase K. 1991. Induction of basidiospore germination by gluconic acid in the ectomycorrhizal fungus Tricholoma robustum. Can J Bot 70:1234–1238.

Kers LE. 1976. Radiigera Zeller, a genus of Gasteromycetes new to Europe. Bot Notiser 129:173–178.

Largent D, Johnson D, Watling R. 1977. How to identify mushrooms to genus III: Microscopic features. Eureka, California: Mad River Press. 148 p.

Lister A. 1925. A Monograph of the Mycetozoa Being a Descriptive Catalogue of the Species in the Herbarium of the British Museum. 3rd ed. Revised by G. Lister. British Museum of Natural History. London. 296 p.

Macbride TH. 1911. A new genus of Myxomycetes? Mycologia 3:39.[CrossRef]

———. 1922. The North American Slime-Moulds. 2nd ed. New York: Macmillian Co. 299 p.

———, Martin GW. 1934. The Myxomycetes. New York: Macmillan Co. 339 p.

Malajczuk N, Trappe JM, Molina R. 1987. Interrelationships among some ectomycorrhizal trees, hypogeous fungi and small mammals: Western Australian and northwestern American parallels. Aust J Ecol 12:53–55.

Malençon G, Riousset L. 1977. Pyrenogaster pityophilus G. Malençon et L. Riousset, nouveau genre et nouvelle espèce de gastéromycète (Geastraceae). Bull Soc Mycol France 93:289–311.

Martin GW. 1949. Myxomycetes. N Am Flora 1:1–190.

———. 1961. The genus Schenella. Mycologia 53:25–30.[CrossRef]

———, Alexopoulos CJ. 1969. The Myxomycetes. Iowa City, Iowa: University of Iowa Press. 501 p.

———, ———, Farr ML. 1983. The genera of Myxomycetes. Iowa City, Iowa: University of Iowa Press. 102 p.

Marx DH. 1969. The influence of ectotrophic mycorrhizal fungi on the resistance of pine roots to pathogenic infections. I. Antagonism of mycorrhizal fungi to root pathogenic fungi and bacteria. Phytopathol 59:153–163.

Maser C, Trappe JM, Nussbaum RA. 1978. Fungal-small mammal interrelationships with emphasis on Oregon coniferous forests. Ecology 59:799–809.[CrossRef]

Molina R, Palmer G. 1982. Isolation, maintenance, and pure culture manipulation of ectomycorrhizal fungi. In: Schenck NC, ed. Methods and principles of mycorrhizal research. Minnesota: The American Phytopathological Society. p 115–129.

Nannenga-Bremekamp NE. 1967. Notes on Myxomycetes. XII. A revision of the Stemonitales. Proc Kon Ned Akad Wetensch C 70:201–216.

———. 1974. De Nederlandse Myxomyceten. Biblioth Kon Nederl Natuurhist Ver 18:1–440.

Queen C, Korn LJ. 1984. A comparative sequence analysis program for the IBM personal computer. Nucleic Acids Res 12:581–599.[Medline]

Rammeloo J. 1985. Schenella simplex Macbride. In: Rammeloo J, ed. Icones Mycolgicae 93–110. Pl. 110. Nationale Plantetuin van België, Meise.

Rodríguez-Palma M, Estrada-Torres A. 1996. Some Stemonitales (Myxomycetes) from the state of Tlaxcala, Mexico. Mycotaxon 60:79–102.

Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487–491.[Abstract/Free Full Text]

Tejeda-Martínez A, Acevedo F, Jáuregui E. 1989. Atlas climático del estado de Veracruz. Universidad Veracruzana, Xalapa, Veracruz.

Trappe JM. 1988. Lessons from alpine fungi. Mycologia 80: 1–10.[CrossRef]

Zeller SM. 1944. Representatives of the Mesophelliaceae in North America. Mycologia 36:627–637.[CrossRef]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Estrada-Torres, A.
Right arrow Articles by Keller, H. W.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Estrada-Torres, A.
Right arrow Articles by Keller, H. W.
Agricola
Right arrow Articles by Estrada-Torres, A.
Right arrow Articles by Keller, H. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS