Mycologia
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peterson, S. W.
Right arrow Articles by Wicklow, D. T.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Peterson, S. W.
Right arrow Articles by Wicklow, D. T.
Agricola
Right arrow Articles by Peterson, S. W.
Right arrow Articles by Wicklow, D. T.
Mycologia, 96(6), 2004, pp. 1280-1293.
© 2004 by The Mycological Society of America

Penicillium thiersii, Penicillium angulare and Penicillium decaturense, new species isolated from wood-decay fungi in North America and their phylogenetic placement from multilocus DNA sequence analysis


Stephen W. Peterson 1

     Microbial Genomics and Bioprocessing Research Unit, National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 N. University St., Peoria, Illinois 61604-3999

Eileen M. Bayer 2
Donald T. Wicklow

     Mycotoxin Research Unit, National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 N. University St., Peoria, Illinois 61604-3999


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 

We describe three new fungicolous species on the basis of phenotypic and phylogenetic differences from known species. Penicillium thiersii, P. angulare and Penicillium decaturense are described. Penicillium thiersii phenotypically is identified on the basis of several characteristics including growth rates, vesicle size and condium shape and roughening. Penicillium angulare is related most closely to P. adametzioides but differs from it by restricted growth rates and conidiophores greater than 60 µm in length. Penicillium decaturense is related most closely to P. miczynskii but differs from that species by growth rate, minimum growth temperature and pigment production on MEA. Multilocus phylogenetic analysis confirmed the genetic distinctiveness of P. decaturense and the closely related species P. miczynskii, P. chrzaszczii and P. manginii. Penicillium rivolii is a synonym of P. waksmanii on the basis of this analysis. Analysis of the EF-1{alpha} gene shows rapid changes of position, number and length of introns between the species, suggesting a recent evolutionary origin for the introns.

Key words: bioactivity, calmodulin, fungi, fungicolous, introns, ITS, natural products, rDNA, systematics, translation elongation factor 1-alpha


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 
In a survey of fungicolous fungi for novel bioactive metabolites (Wicklow et al 1998Go, Holler et al 2002Go), we isolated numerous cultures of Penicillium as colonists of the sporocarps of wood decay fungi (ascomycetes and basidiomycetes) that were collected for this study by Dr Harry D. Thiers, Dr Bruce W. Horn and one of us (DTW). Many of these isolates could not be identified satisfactorily using the available Penicillium monographs (Raper and Thom 1949Go, Pitt 1980Go, Ramirez 1982Go). In an attempt to identify these taxa we sequenced the ITS and ca. 650 nucleotides of the large subunit rDNA (the combined sequences are termed the ID region) for comparisons to homologous sequences obtained from ex-type Penicillium cultures. Some isolates were so different from known species that the ID sequence alone strongly suggested that they were new taxa. For other isolates, genes encoding translation elongation factor 1-alpha (EF-1{alpha}) and calmodulin (CAL) also were sequenced because there were few differences from known species in the ID region.

Among these cultures were three putative new species of particular interest because they are the sources of a variety of novel bioactive compounds (Li et al 2002Go, 2003Go; Zhang et al 2003Go). In the present study, we provide descriptions of these new Penicillium species.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 
Isolation of cultures. – Collections of wood decay fungi, with portions of the woody substratum on which fungal sporocarps had formed were placed in individual plastic bags and stored frozen (–7 C) until they could be processed. To isolate microfungal colonists, sporocarp surfaces, including stromata (Xylariales) and basidiomata of polypores (Polyporaceae) were abraded gently using a sterilized fingernail file. The filings of stromata or polypore tissues were plated directly onto the surface of dextrose-peptone yeast-extract agar (DPYA) containing streptomycin (25 mg/L) and tetracycline (1.25 mg/L) (Papavizas and Davey 1959Go). Plates were incubated in the dark at 25 C for 5 d and cultures representing each colony type, showing a distinctive morphology on DPYA, were isolated as slant cultures on potato-dextrose agar (PDA, Difco). After 7–12 d incubation, the tube cultures were segregated into groups of presumptive taxa, examined for cultural purity and maintained for identification. Cultures of Penicillium then were subcultured onto slant cultures of Czapek’s agar (CZA, Difco). After 10–14 d incubation the tube cultures were segregated further into presumptive taxon groupings. A maximum of eight representatives were kept for each taxon.

A culture of Penicillium was isolated in Sep 2001 from the shell (endocarp) of a mature fallen walnut fruit (Juglans sp.) collected in Peoria, Illinois, and it had DNA sequences matching one of the new Penicillium species and therefore was included in this study. We compiled the geographic and substratum origin of the isolates, NRRL accession numbers for the cultures and GenBank accession numbers for the ID region DNA sequences derived from them (TABLE IGo). These cultures are preserved permanently in the Agricultural Research Service Culture Collection (NRRL), Peoria, Illinois.


View this table:
[in this window]
[in a new window]
 
TABLE I. Origin of fungi used in this study
 
Growth media and conditions and DNA isolation. – Cultures were grown on Czapek’s agar with yeast extract (CYA), malt-extract agar (MEA) and 25% glycerol agar (G25N). Preparation of these media is detailed by Pitt (1980)Go. Morphological and physiological observations were made on cultures that had been grown 7 d at 5 C, 25 C or 37 C in the dark (Pitt 1980Go). The color names are from Ridgway (1912)Go and are cited by plate number. Statistical treatment of the data was performed using Microsoft Excel.

For DNA isolation, mycelium was scraped from a 7–10 d old culture grown on an agar slant in a test tube (Peterson et al 2003Go). The mycelium was placed in a screw-cap tube with buffer and glass beads, and the mycelium was broken by vortex mixing. Proteins were extracted with phenol/chloroform (1 g/mL), nucleic acids were precipitated with ethanol, and the final purification of the DNA was by adsorption to a silica matrix in the presence of a chaotropic agent (GeneClean, Qbiogene, La Jolla, California) as described by the manufacturer.

The ITS-lsu rDNA fragment was amplified using published PCR techniques (White et al 1990Go, Peterson 2000Go).

Calmodulin (CAL) fragments were amplified as detailed by Peterson et al (2001)Go with the universal 3' primer CF4 (5' –tttYtgcatcatRagYtggac) and a series of 5' primers were developed and used for different taxa, CF1B (5' –gccgactcttgactgaa), CF1C (5' –gaagaacaggtctccgag), CF1D (5' –caggtctccgagtacaag). CFM (5' –gacaaggatggcgatggt) and CFMR (5' –accatcgccatccttgtc) were used as internal primers for sequencing.

Translation elongation factor 1-alpha (EF-1{alpha}) fragments were amplified using the universal 3' primer EF6 (5' –ctt-StYccaRcccttgtacca) and 5' primers EF1c (5' –tcgtcgttatcggccacgtc) and EF1d (5' –ggccacgtcgattccgg. EFM (5' –tggaaRggYcaRacNgc) and EFMr (5' –gcNgtYtgRaaYttcca) were used as internal sequencing primers.

The reaction buffer was described by White et al (1990)Go and the thermal profile was 96 C for 2 min followed by 42 cycles of 96 C for 30 s, 51 C for 30 s, 72 C for 90 s and a final elongation reaction of 5 min at 72 C. Amplified fragments were purified using the Millipore Multiscreen PCR system as detailed by the manufacturer (Millipore, Billerica, Massachusetts). Purified fragments were sequenced with the terminal primers used in amplification plus the internal primers noted and fluorescent dye labeled dideoxy nucleotide terminators in the Applied Biosystem Dye-deoxy sequencing kits. Sequences were read on an Applied Biosystems model 377, 3100 or 3730 DNA sequencer. The sequencing procedures are performed in accordance with the manufacturer’s instructions.

DNA sequence analysis. – Sequences were rough aligned using Clustal V (Thompson et al 1994Go) and a text editor was used to visually optimize the Clustal V alignment. Maximum parsimony trees were calculated using PAUP* (Swofford 1998Go) in heuristic search with random addition order (10 replications). Bootstrap values were determined using PAUP* heuristic search in 1000 replicates. Tree diagrams were viewed using TreeView (Page 1996) and redrawn for publication using CorelDraw 9.0.

Scanning electron microscopy. – SEM samples were prepared by OsO4 fixation overnight, dehydration in increasingly concentrated acetone, critical-point drying and sputter coating with gold/palladium (Peterson 1992Go). Specimens were examined and images digitally recorded using a JEOL scanning electron microscope. Photographs were taken using a Kodak 420B digital camera. Microphotographs were made using the Kodak 420 B digital camera attached to a Zeiss axioscope with phase-contrast or DIC illumination from samples teased apart and mounted in 0.5% Kodak photoflo. Photographs and SEM images were sized and fitted into composite figures using Photoshop 6.0.1.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 
DNA sequences (ITS and lsu-rDNA) from the putative new species were compared to those in GenBank and to a number of additional sequences derived from ex type cultures of Penicillium species (S.W. Peterson unpubl) using BLAST (Altschul et al 1997Go) in a local implementation. The sequences from NRRL 28147, NRRL 28162 and NRRL 31609 were identical and differed at about 5% of the nucleotide positions from the most closely related Penicillium species. Sequences from NRRL 28140 and NRRL 28157 were identical and differed from the sequence of P. adametzioides at about 1% of the nucleotide positions. Sequences of NRRL 28119, NRRL 28152 and NRRL 28160 were identical and differed from that of NRRL 1077, the ex-type culture of P. miczynskii at less than about 1% of nucleotide positions. A parsimony tree was calculated that included Penicillium species in GenBank plus some unpublished sequences (more than 160 taxa not shown here). Strict consensus of the 25 000 trees generated in that analysis showed that NRRL 28157 always occurred on the branch with P. adametzioides, that NRRL 28160 always branched next to P. miczynskii, and that NRRL 28147 branched deeply in the tree and these data provided no consensus on its location relative to other species.

A subset of 48 ID region sequences, including representatives of each Penicillium phylogenetic group (Peterson 2000Go), were analyzed using the maximum parsimony criterion (FIG. 1Go). While many branches were supported in more than 90% of the bootstrap samples, the more basal branches of the tree had only weak statistical support. Additional sequences from CAL and EF-1{alpha} were obtained for the species most closely related to P. miczynskii to compare with the ID region tree.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 1. Phylogram calculated using ID region data and parsimony criterion in PAUP*. Dataset composed of 1180 characters, of which 126 were excluded from analysis because of indels, 806 were constant, 82 were parsimony noninformative and 166 were parsimony informative. The search produced 20 equally parsimonious trees of 579 steps, with CI = 0.5475 and RC = 0.4324. The bootstrap values are placed on the branches of one of the maximum parsimony trees. Penicillium angulare is most closely related to P. adametzioides and P. bilaiae, the relationship of Penicillium thiersii to other Penicillium species is not established by the current dataset. Penicillium decaturense forms a strongly supported clade with P. miczynskii. Treebase accession number M2076-8.

 
The PCR amplified CAL fragment included amino acid codons 9–148 (total protein consists of 149 amino acids). Introns were inserted after codon 20, at codon 26 between nucleotides 1 and 2, at codon 68 between nucleotides 1 and 2, and at codon 139 between nucleotides 1 and 2, positions identical to those found in the CAL gene of A. oryzae. Intron sequences were aligned easily for the ingroup with small length differences, and while some similarity to outgroup was observed, length differences were more pronounced between ingroup and outgroup (up to 50% length difference). The protein coding region was aligned with no length differences. Nucleic acid sequences were used to predict amino acid sequences of the proteins. The ingroup amino acid sequences were identical, but the proteins predicted for P. jensenii and P. rolfsii showed two amino acid differences from the ingroup.

The amplified fragment of EF-1{alpha} included amino acid codons 15–215 of the 460 AA protein. Introns were inferred with insertion points, at codon 26 between nucleotides 1 and 2; after codon 28; after codon 45; after codon 56; at codon 92 between nucleotides 1 and 2; after codon 132, and after codon 133. Intron lengths varied from 56 to 108 at the different positions, with length differences of 20–30% where more than one species possessed the intron (TABLE IIGo). EF-1{alpha} from A. oryzae has introns at codons 45 and 92 only. The protein coding region was aligned with no length differences, and nucleic acid sequences were used to predict amino acid sequences of the proteins. There were amino acid changes at 11 positions, with most changes occurring in outgroup species relative to ingroup. Intron sequences were used in BLAST searches of the GenBank nucleic acid databases, but no significant homology was found to reverse transcriptases or any other genes.


View this table:
[in this window]
[in a new window]
 
TABLE II. Location of introns in EF-1{alpha}. Numbering of introns was explained in text. Intron 56 is shared by the ingroup but not outgroup species, intron 133 is shared by the P. waksmanii group. Introns 26, 45, and 92 are unique to the outgroup species
 
Heuristic search of the CAL data produced more than 100 equally parsimonious trees of length 607. The strict consensus of those trees is indicated by bold lines in the tree diagram (FIG. 2Go). Heuristic search of the EF-1{alpha} data produced more than 100 equally parsimonious trees and the strict consensus of those trees is indicated by bold lines (FIG. 3Go). Bootstrap values are on the tree branches.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2. One of more than 100 equally most parsimonious trees of 451 steps derived from the calmodulin dataset. The data included 136 phylogenetically informative sites. The consistency index was 0.8936, and the recalculated consistency index was 0.7947. Bootstrap percentages above 70 are indicated on the tree. Treebase M2076-8. GenBank No. AY443472–AY443490.

 


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 3. One of more than 100 equally most parsimonious trees of 267 steps from the EF-1{alpha} dataset. The data included 106 phylogenetically informative sites. The consistency index was 0.8839, and the recalculated consistency index was 0.7919. Bootstrap percentages above 70 are indicated on the tree. The presence of introns is indicated, with all isolates to the right of the intron listing possessing the particular intron. Intron 56 is common to the ingroup while other introns are unique to more terminal clades. Treebase M2076-8. GenBank No. AY443450–AY443468.

 

    TAXONOMY
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 
Penicillium thiersii SW Peterson, EM Bayer & DT Wicklow, sp. nov. FIGS. 4Go, 7–12Go



View larger version (58K):
[in this window]
[in a new window]
 
FIGS. 4–6. Penicillium species grown on CYA 7 d. 4. P. thiersii NRRL 28147 showing the radial sulcations and bright yellow colony. 5. P. angulare NRRL 28157 showing the angular outline and sulcate centrally sunken colony. 6. P. decaturense NRRL 28152 showing radial sulcation, light grayish blue conidial coloration and clear to yellow exudate on the colony.

 


View larger version (140K):
[in this window]
[in a new window]
 
FIGS. 7–12. Penicillium thiersii NRRL 28147. 7–9, light micrographs using phase contrast (FIG 7) or DIC. In each figure, the large bulbous vesicle subtending the conidiogenous cells is indicated by arrows. 10. SEM photograph of penicillus showing long narrow phialides and elongate conidia. 11. Light micrograph using DIC contrast showing conidia in aqueous mounting medium. 12. SEM view of conidia. Shrinkage of the samples during drying might have exaggerated the elliptical shape of the conidia and the ornamentation, which are not as pronounced in FIG. 11. Scale: bar = 10 µm in Figs. 7–11, bar = 1 µm in FIG. 12.

 
Coloniae velutinosae, radialiter sulcatae, barium-flavae in CYA; velutinosae, glauco-griseae in MEA; color faciei aversae primulino-flavus ad ochraceus in CYA, olivaceo-flavus in MEA, moderatim bene crescentes. Conidiophora monoverticillata, vesiculata, 250–500 x 3–4 µm, vesicula 7–10 µm cum verticillis phialidum ampulliformium 8 ad 12, 9–12 x 2.0–3.0 µm, producentia conidia levia et elliptica 3–4 x 2.0–2.5 µm.

Colonies (FIG. 4Go) grown 7 d on CYA at 25 C 37–42 mm diam, consisting of a closely woven felt of hyphae, thin (ca. 1 mm), velutinous, radially sulcate, pinard yellow (R-IV) to barium yellow (R-XVI), colony margin on the surface, a 1–2 mm peripheral white band of hyphae, moderate amounts of clear exudate present, no soluble pigments produced, sporulation moderate, colony reverse primuline yellow (R-XVI) marginally to yellow ocher (R-XV) centrally. Conidiophores scattered through the colony 250–500 x 3–4 µm, arising from basal hyphae, and slightly roughened near the apex terminating in a 7–10 µm diam vesicle (X = 7.61 n = 15, FIGS. 7–9Go). Penicillus (FIGS. 7–10Go) monoverticillate bearing 8–12 ampulliform, 9–12 x 2.0–3.0 µm phialides (X = 11 ± 1.6 x 2.9 ± 0.3 n = 18, FIG. 10Go). Conidia (FIGS. 11, 12Go) are ellipsoidal, 3–4 x 2.0–2.5 µm (X = 3.6 ± 0.4 x 2.5 ± 0.3 n = 18), smooth in light microscopy (FIG. 11Go).

Colonies grown 7 d on MEA at 25 C 37–40 mm diam, velutinous to lanose, colored dark glaucous gray (R-XLVIII), marginal ring white 3–4 mm, moderate to heavy sporulation, exudate and soluble pigments absent, colony reverse olive yellow (R-XXX) to yellowish citrine (R-XVI). Conidiophores, phialides, conidia and other microscopic features as described from CYA.

No growth or germination of conidia on CYA at either 5 C or 37 C. On G25N, colonies 14–15 mm diam after 7 d at 25 C.

Etymology. – Named in honor of Professor Harry D. Thiers.

HOLOTY PE. BPI 842269 here designated. Dried colony of NRRL 28147 grown 7 d at 25 C on MEA and CYA.

Cultures examined. – UNITED STATES. ILLINOIS: Peoria, Galena Road, ca. 40°44'N, 89°35'W, isolated from the shell of a mature, fallen walnut fruit (Juglans sp.) collected Sep 2001, J.J. Scoby (Culture NRRL 31609). WISCONSIN: New Glarus, New Glarus Woods State Park, ca. 42°48'N, 89°38'W, isolated as "Myc-500 Penicillium sp." from an old, black stroma of Hypoxylon encrusting the surface of a dead maple log (Acer saccharum Marsh.) collected 21 Aug 1996, H.D.Thiers No. 55623 (Culture NRRL 28147 ex type); culture NRRL 28162, a second isolate from the same stroma as above.

Commentary. – P. thiersii colonies grown on CYA tend to develop sporulation tardily, and this might be the cause of the bright yellow colony color. After 14 d growth, colonies of NRRL 28147 display moderately heavy sporulation in the marginal 30% of the colonies in bluish-green.

On the basis of long vesiculate stipes and rugose conidial walls, P. thiersii fits into ser. Glabra (Pitt 1980Go). Green conidia, in mass, and ellipsoidal, rugose conidia suggest P. thomii (Pitt 1980Go). Arguing against inclusion of these isolates in P. thomii are the CYA growth rates (P. thomii 40–60 mm, P. thiersii 38–42 mm), G25N growth rates (P. thomii 20–24 mm, P. thiersii 14–16 mm), vesicle size (P. thomii 4–6 µm, P. thiersii 7–10 µm diam) and the failure of P. thiersii to form the pinkish sclerotia commonly found in P. thomii isolates.

On the basis of no sclerotium production, velutinous colonies and ellipsoidal conidia, P. thiersii fits into the P. lividum series (Ramirez 1982Go) and of the species in the series, most closely resembles P. lividum. However, P. lividum colonies are lanose and blue-green while those of P. thiersii are barium yellow and velutinous; P. lividum produces yellow soluble pigments, P. thiersii does not; P. lividum produces smaller vesicles (5–6 µm) than P. thiersii; the phialides are larger in P. lividum 11–16 x 2.5–4 µm versus 9–12 x 2–3 µm; and conidia of P. lividum are roughened, 4–5 x 3–4 µm while those of P. thiersii are ellipsoidal 3–4 x 2.0 x 2.5 µm and smooth in light microscopy.

Analysis shows that P. thiersii phylogenetically is distinct from any of the species that it phenotypically resembles.

Penicillium angulare SW Peterson, EM Bayer & DT Wicklow, sp. nov. FIGS. 5Go, 13, 14Go



View larger version (180K):
[in this window]
[in a new window]
 
FIGS. 13, 14. Penicillium angulare NRRL 28157. 13. Light micrograph of a penicillus using DIC. The conidiophore terminates with no noticeable vesicle. 14. SEM view of penicillus showing the smooth non-vesiculate stipe, smooth ampuliform conidiogenous cells (phialides) and slightly roughened elliptical conidia. Scale: bar = 10 µm in FIG. 13, bar = 5 µm in FIG. 14.

 
Coloniae celandinae, velutinosae et sulcatae, polygonales et in media parte depressae in CYA, gnaphalium-griseae et velutinosae in MEA, color faciei aversae baryta-flavus in CYA, Neapolitano-flavus in MEA, incrementum lentum. Conidiophora monoverticillata, non vesiculata, levia, 100–150 x 3–4 µm cum verticillis phialidum ampulliformium 6 ad 10, 8–10 x 2–3 µm, producentia conidia levia et elliptica ad 3.5 x 2.5 µm.

Colonies (FIG. 5Go) grown 7 d on CYA at 25 C 13–18 mm diam, velutinous and sulcate, not distinctly colored, white with light celandine areas (R-XLVII), irregular to polygonal in shape and sunken centrally (FIG. 5Go), margin on the agar surface, small amounts of clear exudate present, soluble pigments absent, sporulation light, colony reverse baryta yellow (R-IV). Conidiophore smooth, nonvesiculate, measuring 100–150 x 3–4 µm, penicillus (FIG. 13Go) monoverticillate arising from basal hyphae, with phialides 8–10 x 2–3 µm (X = 8.5 ± 0.6 x 2.6 ± 0.3 n = 15), arranged in whorls of 6–10 bearing smooth ellipsoidal conidia up to 3.5 x 2.5 µm (X = 3.2 ± 0.4 x 2.4 ± 0.4 n = 13, FIG. 14Go).

Colonies grown on malt agar at 25 C for 7 d 9–15 mm diam, velutinous with heavy sporulation, gnaphalium gray (R-XLVII) with a 1 mm white margin on the agar surface. Exudate and soluble pigments absent, colony reverse Naples yellow (R-XVI). Microscopic features as described from CYA.

No growth or at most micro colony formation on CYA plates at 5 C. At 37 C, no growth or germination. Colonies at 25 C on G25N agar 10–12 mm diam.

Etymology. – angulare refers to the angular colony appearance when grown on CYA.

HOLOTY PE. BPI 842268 here designated. Dried colony of NRRL 28157 grown 7 d at 25 C on MEA and CYA.

Cultures examined.—UNITED STATES. NEW MEXI-CO: Red River, Mount Wheeler Road, ca. 105°30'W, 36°35'N, isolated as "Myc-545 Penicillium sp." from an old polypore found on a dead conifer stump collected 5 Sep 1996, H.D. Thiers No. 55690 (Culture NRRL 28157, ex type); Mount Wheeler Road, ca. 105°30'W, 36°35'N, isolated as "Myc- 424 Penicillium sp." from an old polypore found on a dead conifer stump collected 5 Sep 1996, H.D. Thiers No. 55686 (Culture NRRL 28140).

Commentary. – Pencillium angulare is a species of sect. Exilicaulis (Pitt 1980Go) but differs from all species of the section in its slow growth (<25 mm) and long (>60 µm) condiophores.

Following Ramirez (1982)Go this isolate can be identified only as P. hispanicum Ramirez et al, because of the colony growth rate and monoverticillate penicillus. However, there are several differences between P. angulare and P. hispanicum. Penicillium angulare produces no soluble pigments, while P. hispanicum produces yellow-orange pigments that diffuse through the agar plate, and the colonies of P. hispanicum have an irregular margin, while the colonies of P. angulare have a smooth margin. Penicillium angulare produces conidiophores 100–150 x 3–4 µm with no noticeable vesicle at the apex, while conidiophores of P. hispanicum are up to 100 x 2–2.5 µm and terminate in an apical vesicle up to 7 µm diam. Conidia of P. angulare are ellipsoidal 3.5 x 2.5 µm while the conidia of P. hispanicum are globose to subglobose 3–4 µm diam.

In phylogenetic analysis based on the ID sequence region (FIG. 1Go), P. angulare is most closely related to P. adametzioides Abe ex G. Smith but differs from that species in several ways. When grown on CYA, P. adametzioides colonies attain ca. 50 mm diam in 14 d, produce yellow soluble pigments and reverse color is orange, while P. angulare colonies attain 9–15 mm diam on CYA in 7 d, produce no soluble pigments and colony reverse color is bright yellow. Stipes of P. adametzioides rarely exceed 25 µm length and produce a 4.5 µm diam vesicle, while P. angulare stipes are 100–150 µm long and nonvesiculate. Phialides of P. adametzioides are 10–12 x 2.8–4.0 µm and produce smooth ellipsoidal, conidia 3–4.8 x 2.5–4.0 µm while P. angulare produces phialides 8–10 x 2–3 µm and smooth, ellipsoidal conida up to 3.5 x 2.5 µm. These species as well as P. bilaiae, P. herquei, P. sclerotiorum and P. adametzii occur on a strongly supported branch that has been referred to as group 3 (Peterson 2000Go). The very high bootstrap values strongly support the distinction of P. angulare from P. adametzioides and other species.

Penicillium decaturense SW Peterson, EM Bayer & DT Wicklow, sp. nov. FIGS. 6Go, 15–19Go



View larger version (120K):
[in this window]
[in a new window]
 
FIGS. 15–19. Penicillium decaturense NRRL 28152. 15, 16. Light micrographs of the penicillus structure using phase contrast or DIC illustrating the furcate penicillus. 17. SEM of a penicillus. 18. Conidia in aqueous mounting fluid showing smooth walled subglobose spores. 19. SEM view of conidia showing the subglobose to elliptical shape and lightly roughened outer wall. Scale: bar = 20 µm in FIG. 15, bar= 10 µm in FIGS. 16–18, bar =1 µm in FIG. 19.

 
Coloniae velutinosae, sulcatae, glauco-griseae, producentes sudorem flavum in CYA, velutinosae, artemisia-virides ad saxeo-olivaceae in MEA, color faciei aversae primulino-flavus ad malum Armeniacum-luteus in CYA, pallide ad produnde uva-viridis in MEA. Conidiophora furcata, ad 150 x 2.5–3.0 µm, metulae 10–15(–20) x 2.5–3.0 µm producentes phialides ampulliformes 6–10.0 x 2.5 µm cum conidiis sphericis et levibus 2.0–2.5(–3.0) µm diam.

Colonies (FIG. 6Go) grown at 25 C for 7 d on CYA 31–37 mm diam, velutinous, sulcate, white and deep glaucous gray (R-XLVIII) to dawn gray (R-LII) with yellow to reddish shades centrally coming from exudate, margin on the agar surface, exudate yellow, soluble pigments absent, sporulation heavy, reverse primuline yellow (R-XVI) to apricot buff (XIV).

Colonies grown on malt agar 7 d at 25 C 26–27 mm diam, artemisia green to slate-olive (R-XLVII) margin 3 mm wide white, on the agar surface, exudate and soluble pigments absent, sporulation heavy, reverse pale to deep grape green (R-XLI), influenced by the surface color.

No growth or germination of conidia on CYA at 5 C or 37 C. On G25N at 25 C, colonies 15–17 mm diam in 7 d.

Conidiophores (FIGS. 15–17Go) up to 150 µm in length, smooth and arising from basal hyphae, diameter below metulae 2.5–3.0 µm, penicillus furcate (FIG. 15–17Go) with metulae 10–15(–20) x 2.5–4 µm(X = 12 ± 2 x 3 ± 0.2 n = 90) and ampulliform phialides 6–10 x 2.5 µm (X = 7.6 ± 0.7 x 2.1 ± 0.2 n = 113). Conidia (FIGS. 18, 19Go) globose, smooth, 2.0–2.5(–3.0) µm diam (X = 2.13 ± 0.2 n = 115).

Etymology. – The species name refers to Decatur, Illinois, collection site of the holotype.

HOLOTY PE. BPI 842267, here designated. Dried colony of NRRL 28152, grown 7 d on CYA and MEA.

Cultures examined. – UNITED STATES. Locality unknown, isolated 1997 from a wood-decaying fungus collected 1996, H.D. Thiers (Culture NRRL 28119). ILLINOIS: Decatur, Ramsey Lake State Park, ca. 39°10'N, 89°10'W, isolated 5 Jul 1997 from an old resupinate fungus collected 12 Aug 1996, H.D. Thiers (Culture NRRL 28152, ex type); Peoria, North Picture Ridge Road, ca 40°47'N, 89°35'W, isolated 7 Jul 1997 from an old basidiomata of Ischnoderma sp. found on a dead hardwood log, 5 Sep 1996, H.D. Thiers (Culture NRRL 28160). FLORIDA: Crawfordsville, Wakulla Springs State Park, dry cypress swamp ca. 30°10'N, 84°22'W, isolated 20 Jun 2000 from Trichaptum biformis on a dead hardwood branch collected 1 May 2000, D.T. Wicklow (Culture NRRL 29828); Blountstown, Torreya State Park mixed hardwood-cypress-pine forest ca 30°26'N, 85°3'W, isolated 28 Jun 2000 from a polypore found on a dead pine branch collected 2 May 2000, D.T. Wicklow (Culture NRRL 29840). GEORGIA: Albany, Chehaw Park, mixed hardwood-pine forest ca 31°34'N, 84°10'W, isolated 4 Jun 2000 from Trichaptum biformis found on a dead hardwood branch collected 29 Apr 2000, B. W. Horn (Culture NRRL 29675); Adel, Reed Bingham State Park, hardwood swamp area ca. 31°8'N, 83°25'W, isolate 14 Jun 2000 from a basidiomycete on dead hardwood collected 29 Apr 2000, B.W. Horn (Culture NRRL 29708). FLORIDA: Hickory Mounds, near Ecofina River and SR 98, Sabal palm swamp ca 30°8'N, 83°40'W, isolated 19 June 2000 from a pyrenomycete stroma on dead hardwood collected 1 May 2000 (D.T. Wicklow).

Commentary. – Colonies on CYA may show a more lanose than velutinous texture in some isolates, and the number of sulcations varies from 3 to 8 by isolate, but they are deep and distinct. Colony color is affected by the texture but is always in light bluish shades when sporulating. Colonies developing more slowly display a white to yellowish white color until conidia develop. Exudate may be present or absent in different isolates and when present may be clear to light yellow.

According to Pitt (1980)Go this species may be identified as P. madriti or as P. miczynskii but it is most similar to P. miczynskii. While P. miczynskii is listed (Pitt 1980Go) as conidiating only sparsely on CYA and MEA, P. decaturense sporulates heavily on both of these media. P. decaturense colony growth on CYA is quite similar to that of P. miczynskii, as stated by Pitt (1980)Go. However, on MEA, soluble pigments are absent in P. decaturense as is the yellow-orange colony reverse color of P. miczynskii. In addition, while cultures of P. miczynskii always show some growth at 5 C, P. decaturense shows no growth or conidium germination.

Phylogenetically, P. decaturense occurs on a branch with P. miczynskii, P. rivolii, P. waksmanii, part of group 1 (Peterson 2000Go). The branch is supported in 100% of the bootstrap samples. Penicillium soppii, sometimes regarded as a synonym of P. miczynskii (e.g., Pitt 1980Go) appears in the parsimony tree in a different branch from P. miczynskii (FIG. 1Go) which is consistent with other analyses (Christensen et al 1999Go). In a GenBank search, this species varies at a single base position from a putative new species ‘P. luridum’ which appears in GenBank as a deposit from Tuthill and Frisvad.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 
Phylogenetic analysis of DNA sequence data has shown that Penicillium is divided into two very different clades. One clade includes species of Eupenicillium along with most of the species placed in subgenera Aspergillioides, Furcatum and Penicillium. The second clade contains species from Penicillium subg. Biverticillium and species with Talaromyces teleomorphs (Berbee and Taylor 1992Go, Lobuglio et al 1994Go, Berbee et al 1995Go, Ogawa and Sugiyama 2000Go). Peterson (1993)Go showed that species assigned to subg. Penicillium appear to be monophyletic, but Peterson et al (1999)Go showed that species from subgenera Aspergillioides and Furcatum are often sister taxa and no larger grouping of monoverticillate or furcate species can be defined phylogenetically. The furcate and monoverticillate penicillus are useful in taxonomy and identification of isolates, but the taxonomy of these subgenera does not reflect the phylogeny. Peterson (2000)Go identified seven subclades of the Eupenicillium lineage, most including both monoverticillate and furcate species. Some Penicillium species did not fall into any of these clades (e.g., Penicillium fellutanum and P. charlesii). These species branch together, but their relationship to any other Eupenicillium species was not resolved. Penicillium thiersii also is not part of any of the defined Penicillium subclades (Peterson 2000Go). Finding novel structural classes of compounds in P. thiersii (Li et al 2002Go, Zhang et al 2003Go) suggests that the species is distinct from previously described species, as we infer from the DNA sequence analysis. While two isolates of P. thiersii were obtained from the same decaying stromata of Hypoxylon sp. collected in southern Wisconsin, a third isolate was recorded from a walnut shell in central Illinois (TABLE IGo). Examination of Penicillium isolates from hundreds of sporocarps of wood-decay fungi collected in Georgia, Florida, Illinois, Wisconsin and New Mexico has revealed no additional cultures of P. thiersii.

Penicillium angulare is known only from collections of two old polypores found on decaying tree stumps within a mixed aspen-spruce forest in the Sangre de Cristo mountains of north-central New Mexico near Red River (TABLE IGo). No additional isolates of P. angulare were recorded from numerous collections of wood-decay fungi that we have examined.

Penicillium decaturense has been isolated as a colonist of fungal sporocarps including pyrenomycete stromata and the basidiomata of polypores (e.g., Trichaptum biformis and Ischnoderma sp., etc.) collected in Illinois, Georgia and Florida (TABLE IGo). Penicillium decaturense is related closely to P. miczynskii, but the multilocus analysis shows that these two species are genetically distinct.

Penicillium waksmanii (subgenus Furcatum, series Fellutana) and P. miczynskii (subgenus Furcatum, series Citrina) are distinct but related species, as suggested by Peterson (2000)Go, despite the wide taxonomic distinctions of the two (Pitt 1980Go). Penicillium manginii is a genetically and phenotypically (Christensen et al 1999Go) valid species, although other authorities have placed it and P. miczynskii in synonymy (Raper and Thom 1949Go, Pitt 1980Go). Penicillium chrzaszcii is seen on a distinct branch close to P. miczynskii at all of the loci examined and has been distinguished phenotypically (Christensen et al 1999Go). Peterson (2000)Go suggested Penicillium rivolii might be a synonym of P. waksmanii on the basis of identical ID region sequences. Multilocus analysis has confirmed synonymy to P. waksmanii. Raper and Thom (1949)Go considered it to be a synonym of P. janthinellum.

Introns are believed to be of ancient origin and the positions and number of introns tend to be strongly conserved (Baldauf and Doolittle 1997Go). This was the case for the calmodulin gene, where each of the Penicillium species possessed the same number and location of introns as those found in Aspergillus oryzae. In EF-1{alpha}, P. jensenii had the same number of introns at the same positions (TABLE IIGo) as A. oryzae but each of the other species either lacked these two introns or had additional introns at other positions. Wendland and Kothe (1997)Go discovered intron differences for the EF-1{alpha} genes of a Zygomycete and a homobasidiomycete species, but the large variation of intron numbers and positions found in these Penicillium species is unusual. The intron positions are overlaid on a phylogenetic tree (FIG. 3Go), and the introns are specific to particular terminal clades. This suggests that these introns arose recently in the evolutionary history of Penicillium and lack the consistency of position and number found in other genes and other organisms (Doolittle 1978Go). The mechanism of intron insertion and deletion in the EF-1{alpha} gene is unknown but does not appear to be related to autonomous mobile genetic elements (Moran et al 1999Go) because Genbank searches showed no intron homology to reverse transcriptases or any other functional genes.


    ACKNOWLEDGMENTS
 
We are grateful to the late Dr Harry D. Thiers for collecting the fungal sporocarps, from which these cultures of Penicillium were isolated, while participating in the ARS Volunteer Program (1995–97). Bruce W. Horn helped with field collections in Georgia. Michael Hertwig translated the diagnoses into Latin.


    FOOTNOTES
 
Accepted for publication April 6, 2004.

2 Current address: Department of Neurobiology and Physiology, Northwestern University, Evanston, Illinois 60208. Back

1 Corresponding author. E-mail: peterssw{at}ncaur.usda.gov


    LITERATURE CITED
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402.[Abstract/Free Full Text]

Baldauf SL, Doolittle WF. 1997. Origin and evolution of the slime molds (Mycetozoa). Proc Natl Acad Sci (USA) 94: 12007–12012.[Abstract/Free Full Text]

Berbee ML, Taylor JW. 1992. Two Ascomycete classes based on fruiting body characters and ribosomal DNA sequences. Mol Biol Evol 9:278–284.[Abstract]

———, Yoshimura A, Sugiyama J, Taylor JW. 1995. Is Penicillium monophyletic? An evaluation of phylogeny in the family Trichocomaceae from 18S, 5.8S and ITS ribosomal DNA sequence data. Mycologia 87:210–222.

Christensen M, Frisvad JC, Tuthill D. 1999. Taxonomy of the Penicillium miczynskii group based on morphology and secondary metabolites. Mycol Res 103:527–541.

Doolittle WF. 1978. Genes in pieces: were they ever together? Nature (London) 272:581–582.

Holler U, Gloer JB, Wicklow DT. 2002. Biologically active polyketide metabolites from an undetermined fungicolous hyphomycete resembling Cladosporium. J Nat Prod 65:876–882.[Medline]

Li C, Gloer JB, Wicklow DT, Dowd PF. 2002. Thiersinine A and B: novel antiinsectan indole diterpenoids from a new fungicolous Penicillium species (NRRL 28147). Organic Lett 4:3095–3098.

———, ———, ———. 2003. Thiersindoles A-C: new indole diterpenoids from Penicillium thiersii. J Nat Prod (66:1232–1235).

Lobuglio KF, Pitt JI, Taylor JW. 1994. Independent origins of the synnematous Penicillium species, P. duclauxii, P. clavigerum, and P. vulpinum, as assessed by two ribosomal DNA regions. Mycol Res 98:250–256.

Moran JV, DeBerardinis RJ, Kazazian HH. 1999. Exon shuffling by L1 retrotransposons. Science 283:1530–1534.[Abstract/Free Full Text]

Ogawa H, Sugiyama J. 2000. Evolutionary relationships of the cleistothecial genera with Penicillium, Geosmithia, Merimbla and Sarophorum anamorphs as inferred from 18S rDNA. In: Samson RA, Pitt JI, eds. Classification of Penicillium and Aspergillus: integration of modern taxonomic methods. Reading, UK: Harwood Publishers. p 149–162.

Page RDM. 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12:357–358.[Free Full Text]

Papavizas GC, Davey CB. 1959. Evaluation of various media and antimicrobial agents for isolation of soil fungi. Soil Sci 88:112–117.

Peterson SW. 1992. Neosartorya pseudofischeri sp. nov. and its relationship to other species in Aspergillus section Fumigati. Mycol Res 96:547–554.

———. 1993. Molecular genetic assessment of relatedness of Penicillium subgenus Penicillium. In: Reynolds DR, Taylor JW, eds. The fungal holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics. Oxon, UK: CAB International. p 121–128.

———, Corneli S, Hjelle JT, Miller-Hjelle MA, Nowak DM, Bonneau PA. 1999. Penicillium pimiteouiense: a new species isolated from polycystic kidney cell cultures. Mycologia 91:269–277.

———. 2000. Phylogenetic analysis of Penicillium based on ITS and LSU-rDNA sequences. In: Samson RA, Pitt JI, eds. Classification of Penicillium and Aspergillus: integration of modern taxonomic methods. Reading, UK: Harwood Publishers. p 163–178.

———, Ito Y, Horn BW, Goto T. 2001. Aspergillus bombycis, a new aflatoxigenic species and genetic variation in its sibling species, A. nomius. Mycologia 93:689–703.

———, Pérez J, Vega FE, Infante F. 2003. Penicillium brocae, a new species associated with the coffee berry borer in Chiapas, Mexico. Mycologia 95:141–147.[Abstract/Free Full Text]

Pitt JI. 1980. The Genus Penicillium and its teleomorphic states Eupenicillium and Talaromyces. New York: Academic Press. 634 p.

Ramirez C. 1982. Manual and Atlas of the Penicillia. New York: Elsevier Biomedical Press. 874 p.

Raper KC, Thom C. 1949. A manual of the Penicillia. Baltimore, Maryland: The Williams and Wilkins Company. 875 p.

Ridgway R. 1912. Color Standards and Color Nomenclature. Washington, D.C.: Published by the author. 43 p, 53 plates.

Swofford DL. 1998. PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods). Version 4. Sunderland, Massachusetts: Sinauer Associates.

Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal V: improving the sensitivity of progressive multiple sequence alignments through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680.[Abstract/Free Full Text]

Wendland J, Kothe E. 1997. Isolation of tef1 encoding translation elongation factor EF1{alpha} from the homobasidiomycete Schizophyllum commune. Mycol Res 101:798–802.

White TJ, Bruns TD, Lee SB, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal DNA for phylogenetics. In: Innes MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR Protocols: a guide to the methods and applications. New York: Academic Press. p 315–322.

Wicklow DT, Joshi B, Gamble W, Gloer JB, Dowd PF. 1998. Antifungal metabolites, monorden, monocillin and cerebrosides from Humicola fuscoatra Traaen NRRL 22980, a mycoparasite of Aspergillus flavus sclerotia. Appl Environ Microbiol 64:4482–4484.[Abstract/Free Full Text]

Zhang Y, Li C, Swenson DC, Gloer JB, Wicklow DT, Dowd PF. 2003. Novel antiinsectan oxalicine alkalods from two undescribed fungicolous Penicillium spp. Organic Lett 5:773–776.




This article has been cited by other articles:


Home page
MycologiaHome page
S. W. Peterson and B. W. Horn
Penicillium parvulum and Penicillium georgiense, sp. nov., isolated from the conidial heads of Aspergillus species.
Mycologia, January 1, 2009; 101(1): 71 - 83.
[Abstract] [Full Text] [PDF]


Home page
MycologiaHome page
F. E. Vega, F. Posada, S. W. Peterson, T. J. Gianfagna, and F. Chaves
Penicillium species endophytic in coffee plants and ochratoxin A production.
Mycologia, January 1, 2006; 98(1): 31 - 42.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peterson, S. W.
Right arrow Articles by Wicklow, D. T.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Peterson, S. W.
Right arrow Articles by Wicklow, D. T.
Agricola
Right arrow Articles by Peterson, S. W.
Right arrow Articles by Wicklow, D. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS