Mycologia
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kauserud, H.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Kauserud, H.
Agricola
Right arrow Articles by Kauserud, H.
Mycologia, 96(2), 2004, pp. 232-239.
© 2004 by The Mycological Society of America

Genetics

Widespread vegetative compatibility groups in the dry-rot fungus Serpula lacrymans


Håvard Kauserud 1

     Department of Biology, Division of Botany and Plant Physiology, University of Oslo, P.O. Box 1045, Blindern, N-0316 Oslo, Norway

    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 

Serpula lacrymans is the most notorious decayer of wooden buildings in temperate regions. The occurrence of geographically widespread vegetative compatibility groups (VCG) in S. lacrymans in Europe is demonstrated in this study. Among 22 heterokaryotic isolates of S. lacrymans, five VCG were found. The most widespread VCG included isolates from Belgium, south and central Norway, separated by more than 1500 km. No other genetic variation, measured as DNA sequence variation or ISSR polymorphisms, was detected between the investigated S. lacrymans isolates, whereas a considerable level of genetic variation was found among five European isolates of the sister taxon, S. himantioides. It is hypothesised that isolates of S. lacrymans have lost their ability to recognize self from nonself due to sharing of similar VC alleles, caused by a recent genetic bottleneck during the establishment in northern Europe. Isolates re-isolated from overlapping mycelial zones between different compatible isolates had significantly slower growth than that of the original isolates and the different isolates within a VCG had different growth morphology, indicating that isolates within a single VCG may belong to different genets.

Key words: Basidiomycota, bottleneck, population structure


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Serpula lacrymans (Wulfen : Fr.) S.F. Gray, referred to as the dry-rot fungus, is the most devastating wood-rotting species in Europe, attacking houses and other wooden structural elements. Yearly, the fungus causes damage of millions of dollars in northern Europe. It is cosmopolitan in distribution, recorded from houses in Asia, Australia, New Zealand, Europe, and North America (Hallenberg and Eriksson 1985Go, White et al 2001Go). Serpula lacrymans is heterothallic (Harmsen 1960Go) and produces pancake-like fruit bodies, 2–20 mm thick. The dry-rot fungus also is capable of vegetative local dispersal by producing mycelial strands with the potential to grow several meters across inorganic materials in search of additional organic materials. It also has been observed that homokaryotic isolates produce arthrospores (Schmidt and Moreth-Kebernik 1991Go, Harmsen 1960Go). Serpula himantioides (Fr. : Fr.) Karst., which is the closest relative of S. lacrymans, has a worldwide natural distribution and can be distinguished from S. lacrymans by the thinner and more tightly connected fruit bodies (Hallenberg and Eriksson 1985Go).

Basidiomycetes have an unpredictable population structure due to their highly variable life histories. As mentioned, the mode of dispersal can be vegetative by asexual spores or mycelia, or sexual by basidiospores. Because basidiomycete genets frequently fragment into geographically separated ramets, the individuality concept is complicated. However, genetic identity among vegetative heterokaryons has been suggested as the basis for the concept of individuals in basidiomycetes (Rayner 1991Go). Vegetative compatibility (VC), often referred to as somatic compatibility in basidiomycetes, is the term used for their ability to recognize self from nonself (Worrall 1997Go). VC reactions traditionally have been used to map local population structure in basidiomycetes (e.g., Vasiliauskas and Stenlid 1999Go).

The recognition of self from nonself is regulated by genes at one to several independent loci, of which at least some are multiallelic (Hansen and Hamelin 1999Go). Two isolates are incompatible if they have different alleles at one or more VC loci. Differences in population structure and history potentially can lead to large differences in the relationship between vegetative compatibility and genetic uniqueness, even within a single species (Malik and Vilgalys 1999Go). The efficiency with which vegetative compatibility can detect genetic identity is dependent on the number of loci and alleles involved. In basidiomycetes, field isolates (heterokaryons) tend to be incompatible when paired (e.g., Kauserud and Schumacher 2002Go), suggesting that VCG normally correspond to genetic individuals, although exceptions occur (Stenlid and Vasiliauskas 1998Go). In ascomycetes, however, the situation is more diverse and VCG do not show a clear association with genetic individuals (Liu et al 1996Go, Jacobson and Gordon 1991Go). Among ascomycetes, VCG can be spread over large distances, for example in Ophiostoma novo-ulmi (Milgroom and Brasier 1997Go).

Several studies have indicated that S. lacrymans has a narrow genetic base. Identical ITS sequences have been observed among isolates from India and Europe (White et al 2001Go). Likewise, no geographic substructuring has been found among global samples of S. lacrymans using RAPD (White et al 2001Go). Some ITS sequence variation normally is observed at the intraspecific level in basidiomycetes (e.g., James et al 2001Go), and in most other fungi RAPD has proven successful in distinguishing between intraspecific subgroups. Furthermore, a high number of mating factors usually are present in populations of heterothallic basidiomycetes, apparently due to balancing selection (May 1999). In S. lacrymans, however, few mating factors have been observed among isolates (Schmidt and Moreth-Kebernik 1991Go), suggesting little genetic diversity.

The primary observation of vegetative compatibility between isolates of S. lacrymans from different areas revealed that widespread VCG exist in this species. This study has been undertaken to investigate the number and distribution of VCG in northern Europe. Furthermore, the aim was to reveal whether the observed small number of VCG is due to clonality or instead to different genets sharing alleles at VC loci. DNA sequencing and ISSR (RAMS) fingerprinting were performed to evaluate the different hypotheses. Five isolates of S. himantioides also were analyzed and the level of genetic variation was compared to S. lacrymans.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Cultures. – A total of 22 heterokaryotic cultures of S. lacrymans were obtained from culture collections or isolated from buildings in Norway (TABLE I) and grown on 2% malt-extract agar (MEA) at 19 C in the dark. In addition, five isolates of S. himantioides were obtained from Mycotheque de l’Universite catholique de Louvain (MUCL), Belgium (TABLE I). Vegetative compatibility (VC) tests were carried out by placing three 0.125 cm3 inocula of different isolates 3 cm apart on Petri plates (2% MEA), incubating at 19 C, and examining after 3–4 wk. The isolates were paired in all combinations twice (on MEA) to assess the reproducibility of the VC reactions. VC tests also were performed on potato-dextrose agar (PDA) to see whether the reactions were different on another medium. EstimateS, downloaded from http://viceroy.eeb.uconn.edu/estimates (Colwell 1997Go), was used to calculate the accumulation curve of VCG richness against sampling effort, with 500 randomized iterations. New isolates (0.125 cm3 inocula) were re-isolated from the overlapping zone between all compatible isolates and grown on 2% MEA for 2 wk. The radial maximum and minimum distance of the mycelial front were measured, and the average was used further as a measure of growth (mm per 24 h). Radial growth was compared to the radial growth rate of the original cultures and to re-isolations from self-pairings.


View this table:
[in this window]
[in a new window]
 
TABLE I. Isolates of S. lacrymans and S. himantioides included in the study
 
Molecular methods. – DNA was extracted from all isolates using the 2% CTAB miniprep method described by Murray and Thompson (1980)Go with minor modifications: DNA was resuspended in 100 µL sterile dsH2O at the final step of extraction, and DNA templates were diluted 50-fold before PCR amplification. PCR amplification was accomplished using the primers ITS4 and ITS5 (White et al 1990Go) for the ITS1-5.8S-ITS2 nrDNA region, primers B36F (CACCCACTCCCTCGGTGGTG) and B12R (CATGAAGAAGTGAAGACGCGGGAA) for the partial beta tubulin (tub) region (Thon and Royse 1999Go) and primers EF595F (CGTGACTTCATCAAGAACATG) and EF1160R (CCGATCTTGTAGACGTCCTG) for the partial translation elongation factor 1 alpha (tef) region (Kauserud and Schumacher 2001Go). The tub and tef regions include exon as well as intron regions. PCR was performed in 30 µL reactions containing 17.5 µL 50x diluted template DNA and 12.3 µL reaction mix (final concentrations: 4 x 250 µM dNTPs, 0.625 µM of each primer, 2 mM MgCl2 and 1 unit DyNazymeTM II DNA polymerase [Finnzymes Oy, Espoo, Finland]) on a Biometra thermocycler. The ITS and tef amplification program was 4 min at 94 C, followed by 37 cycles of 30 s at 94 C, 35 s at 54 C, 72 C for 40 s, and a final extension step at 72 C for 10 min before storage at 4 C. A similar program was used to amplify tub, except that the annealing temperature was 55 C. tef PCR products were obtained only from two S. himantioides isolates (SH16 and SH24), apparently due to primer mismatch. Automated sequencing was performed on a MegaBACETM 500 DNA Analysis System (Amersham Biosciences, Ohio) using the DYEnamicTM ET Dye Terminator Cycle Sequencing Kit (Amersham Biosciences, Buckinghamshire, England) according to the producer’s directions. PCR products and cycle sequencing products were cleaned respectively with the ExoSAP-IT and AutoSeq96TM Dye Terminator Clean-up Kits according to the producer’s directions (Amersham Biosciences, Ohio). GenBank accession numbers for the sequences are AJ518881AJ518907 (ITS), AJ518064AJ518090 (tub) and AJ518908AJ518931 (tef).

ISSR amplification was performed in 30 µL reactions using the same reaction mixture and concentrations as above, except that the concentration of the ISSR primers was doubled. ISSR primers were adopted from Hantula et al (1996)Go and Vainio and Hantula (1999)Go. The program for the ISSR reactions was: 5 min at 95 C, followed by 37 cycles of 30 s at 95 C, 35 s annealing at various temperatures (see below), 72 C for 40 s, and a final extension step at 72 C for 10 min before storage at 4 C. These annealing temperatures were used for the three ISSR primers (optimized on a Biometra gradient thermocycler): 59 C for DHB(CGA)5, 46 C for DYD(CT)7C, and 63 C for VDH(TCG)5, where D = G/A/T, H = A/T/C, B = C/G/T, Y = C/T and V = A/C/G. Primers DBV(CAT)5 and DDB(CCA)5 also were tested but gave no distinct products for S. lacrymans. Replicated PCR amplifications were performed on all isolates twice to assess the reproducibility of the ISSR fragments. ISSR products were separated on 2% agarose gels stained with ethidium bromide, using 0.5x TBE as running buffer. Results were recorded by photographing the gels over UV light.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Vegetative compatibility groups. – All heterokaryotic isolates (n = 22) were paired in all combinations twice on MEA and once on PDA, which gave identical outcomes. In FIG. 1, typical compatible and incompatible reactions are shown. The confrontations yielded an overall occurrence of five VCGS, referred to as VCG-A to VCG-E. The geographical distributions of the VCGS in northern Europe are shown in FIG. 2. The five VCGS had widespread distributions, all occurring both in Norway and Belgium/Germany. One VCG included six isolates, two VCGS included five isolates, and two VCGS included three isolates (TABLE II). The most frequently occurring group (VCG-E) included one isolate from Belgium, four from southeastern Norway (Oslo) and one from southwestern Norway (Haugesund). VCG-A, a second widespread group, included one isolate from Belgium, three from southeastern Norway and one from central Norway (Rennebu) (FIG. 2). VCG-B included one old isolate from Berlin (SL5) sampled in 1937, as well as a Norwegian isolate sampled in 2002 and isolate SL85 from Belgium (year of collection unknown). In Oslo two isolates (SL162 and SL168) of different VCG type (D and E) were sampled respectively in the fourth and fifth floor of the same building. FIGURE 3 illustrates the cumulative richness of observed VCG types against sampling effort and indicates that most of the existing VCG in this region probably have been detected. The shape of the curve indicates that sampling of more isolates probably would not increase the number of VCG groups.



View larger version (157K):
[in this window]
[in a new window]
 
FIG. 1. Vegetative confrontations between three isolates of Serpula lacrymans on 2% malt-extract agar, of which two isolates are compatible (SL161/SL158) and two pairs are incompatible (SL159/SL161 and SL159/SL158).

 


View larger version (36K):
[in this window]
[in a new window]
 
FIG. 2. Geographical distribution of S. lacrymans isolates and VCG in northern Europe.

 

View this table:
[in this window]
[in a new window]
 
TABLE II. Vegetative compatibility groups and growth rates (mm per 24 h) of the 22 S. lacrymans isolates. The isolates are grouped into five different VCGs (A–E). The average growth rate of re-isolated isolates was 1.60 ± 0.61 (see text)
 


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3. Graph showing the cumulative richness of different VCG types against sampling effort, constructed by random resampling of a variable number of isolates (1–22). The bold line shows the mean value from 500 randomized resamplings and the stippled lines indicate standard deviations. The graph indicates that only five VCG (those detected) may exist in northern Europe.

 
Growth. – Mycelia from the overlapping zone between vegetative compatible isolates were transferred and radial growth measured. As shown in TABLE II, the original cultures had an average growth of 2.48 ± 0.40 mm per 24 h and the re-isolated isolates only 1.60 ± 0.61 mm per 24 h, a highly significant difference (t-test, P < 0.0001). Some of the re-isolated isolates showed a distinctly reduced growth rate and an abnormal cultural morphology. Re-isolations from self-pairings had the similar growth as the original isolates (data not shown). In most cases the two compatible isolates meeting in the overlapping zone were not integrated into one homogenous culture when re-isolated but grew out as two distinct growth forms with mycelial continuity (FIG. 4). These results indicate that the vegetatively compatible isolates apparently do not belong to the same genet. Isolates within a single VCG often had highly variable growth rates. For example, in VCG-E, growth varied from 1.58 mm per 24 h (SL87) to 3.17 mm (SL84).



View larger version (57K):
[in this window]
[in a new window]
 
FIG. 4. a. Isolate SL4 showing normal growth of S. lacrymans on 2% MEA. b and c. Isolates re-established from the interaction zone between the vegetative compatible isolates SL5 and SL85 (b) and SL160 and SL164 (c). No incompatibility zone exists between the two growth forms.

 
DNA sequencing and ISSR analyses. – The ITS1-5.8S-ITS2 (ITS) region and the partial tub and tef regions were amplified and sequenced from the 22 S. lacrymans and the five S. himantioides isolates (except for three isolates of S. himantioides for tef). In S. lacrymans, the ITS, tub and tef products, 594, 434 and 506 bp in length respectively, yielded identical sequences and thus were unable to differentiate among either isolates or VCG. The S. lacrymans sequences differed from S. himantioides in ITS, tub and tef. Among the five S. himantioides isolates, one variable site was found in ITS, and three were found in tub (TABLE III). In tef, nine variable sites differed between two S. himantioides sequences (SH16 and SH24). Furthermore, the ISSR analyses yielded no variation between the 22 S. lacrymans isolates, whereas some variation occurred between the five S. himantioides isolates (FIG. 5). The DBH(CGA)5 primer yielded three distinct and constant fragments in S. lacrymans and a variable number of fragments in S. himantioides. The DYD(CT)7C primer yielded five constant fragments in S. lacrymans and a variable number of fragments in S. himantioides. The VDH(TCG)5 primer yielded two constant fragments in S. lacrymans and one in S. himantioides (data not shown). Primers DBH(CGA)5 and DYD(CT)7C were in combination able to separate all S. himantioides isolates.


View this table:
[in this window]
[in a new window]
 
TABLE III. Variable sequence sites detected in ITS, tub and tef in the S. himantioides isolates. Only two tef sequences were obtained, apparently due to primer mismatch
 


View larger version (46K):
[in this window]
[in a new window]
 
FIG. 5. Agarose gels of PCR-amplified ISSR fragments of 22 heterokaryotic isolates of Serpula lacrymans and five heterokaryotic isolates of S. himantioides, all derived from northern Europe (TABLE I). Fragments on the upper and lower gels were amplified with primers DHB(CGA)5 and DYD(CT)7C, respectively. All S. lacrymans ISSR products are monomorphic, while some variation is observed among the S. himantioides isolates. M = size markers (X-174 DNA digested with HaeIII).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
In this study, the occurrence of five geographically widespread VCG has been demonstrated among European isolates of S. lacrymans. Different explanations might account for this observation: (i) each VCG might represent an inbred lineage caused by selfing; (ii) each VCG might represent a single genet that has undergone clonal dispersal; or (iii) the vegetative compatible reactions are caused by the sharing of similar VC alleles by different genets.

The first explanation apparently can be ruled out; S. lacrymans several times has been proven to be an outcrossing heterothallic fungus (Schmidt and Moreth-Kebernik 1991Go, Harmsen 1960Go). In contrast, in Stereum sanguinolentum (Alb. & Schwein. Fr.) Fr., it has been demonstrated that secondary homothallism has resulted in the widespread occurrence of VCG groups (Stenlid and Vasiliauskas 1998Go). In Amylostereum areolatum (Fr.) Boidin, a tree pathogenic basidiomycete spread by a wood wasp, clonality has led to the occurrence of widely dispersed VCG (Vasiliauskas, Stenlid and Thomsen 1998Go).

However, the second hypothesis (clonal dispersal) cannot be ruled out fully. Arthrospores have been obser ved in cultures of homokar yotic mycelia (Schmidt and Moreth-Kebernik 1991Go, Harmsen 1960Go), but as far as I know, it never has been observed that mitospores are produced by heterokaryotic mycelia. Serpula lacrymans has the ability to produce mycelial strands, but this is apparently important only for short-distance dispersal, e.g., within buildings. Another argument against the "clonality hypothesis" is the observation of reduced growth of isolates re-isolated from the zone between compatible isolates. If compatible isolates belong to the same genet, it is not expected that reduced growth and abnormal cultural morphology should occur among re-isolated isolates. They should have the same viability as the original cultures. Reduced growth is likely caused by conflicts between different genomes present in the vegetative compatible isolates. As seen in FIG. 4, it appears that the re-isolated isolates in fact contain genetic mosaics, where the original isolates grow side by side interconnected through mycelia. Isolates within a single VCG often had highly variable growth and also variable cultural morphology (e.g., variation in colorization), which indicate that in fact some genetic variation is present. Furthermore, some of the isolates of a single VCG were found to be separated by up to 1500 km and were isolated in time by up to 65 y, observations which make the "clonality hypothesis" less likely. The lack of a distinct geographic pattern of the different VCG does not support clonal dispersal in S. lacrymans either. A more prominent relationship between geographic distribution and distribution of VCGS then would have been expected. The lack of geographic structuring of the VCGS instead might indicate that S. lacrymans has a high basidiospore dispersal capacity. However, long-distance transportation of colonized wood cannot be ruled entirely out as a possible explanation.

A more likely explanation for the observed patterns in S. lacrymans could be that isolates within a VCG often share the same VC alleles due to little genetic variation in the European population. The lack of genetic variation in the European S. lacrymans population contrasts the ITS, tub, tef and ISSR variation observed among five European isolates of the sister taxon S. himantioides. Some ITS sequence variation normally is observed at the intraspecific level in basidiomycetes. For example, between Scandinavian isolates of the wood-decayers Fomitopsis rosea (Alb. et Schw. Fr.) Karst. (n = 16), Phellinus nigrolimitatus (Romell) Bourdot & Galzin (n = 10), and Trichaptum abietinum (Dicks. : Fr.) Ryvarden (n = 7) 6, 20 and 10 mutations occurred in the ITS (Kauserud and Schumacher 2002Go, Kauserud 2001Go). Likewise, three, five and five variable sites were observed in these three species in the same tef region as studied here. Furthermore, the ISSR method has a proven ability to distinguish between closely related isolates of a fungal species. For example, this method was used to separate European isolates of Heterobasidion annosum (Fr.) Bref. (Vainio and Hantula 1999Go).

Overall it seems reasonable to conclude that S. lacrymans has experienced a genetic bottleneck during its establishment in northern Europe. This might have been connected to the period when people in this area started to use wood as building material. The occurrence of a few VCGS often has been taken as evidence of limited sexual reproduction. However, this may not always be the case and few VCGS merely may reflect limited genetic variation in an otherwise sexually reproducing population. In this study, only five different VCGS were found among 22 isolates. The accumulation curve in FIG. 3 indicates that very few VCGS, perhaps only those very few observed, exist in northern Europe. In other words, vegetative compatibility may be a poor indicator of genetic identity in S. lacrymans. A precedent for this occurs in the basidiomycete Suillus granulatus (L.:Fr.)O. Kuntze, for which vegetative compatible isolates were demonstrated not to be genetically identical (Jacobson et al 1993Go).

In a mating study between 10 S. lacrymans isolates (eight European and two Australian), a limited number of mating factors (four A and five B factors) were found (Schmidt and Moreth-Kebernik 1991Go). This parallels the observation of a limited number of VC alleles in S. lacrymans. The observation by Schmidt and Moreth-Kebernik contrasts the common view that high numbers of mating factors exist in basidiomycete populations but supports the hypothesis that S. lacrymans has experienced a recent and narrow genetic bottleneck. The extant knowledge indicates that S. lacrymans has experienced much inbreeding in northern Europe. Basidiospores of S. lacrymans do not germinate readily in culture, which hypothetically could be a result of inbreeding depression. However, S. lacrymans has a highly viable and infectious population in Northern Europe, which does not indicate inbreeding depression. The development of codominant markers, e.g., microsatellites, for S. lacrymans probably would illuminate this topic more thoroughly.

This study calls for more knowledge about the vegetative compatibility system in S. lacrymans, i.e., the number of loci and alleles that are involved. When the vegetative compatibility system is more fully understood, VC reactions may be used in population genetic analysis of S. lacrymans, as has been done in Cryphonectria parasitica (Milgroom and Cortesi 1999Go) using tester strains. Refined molecular analyses, such as AFLP or microsatellite analysis, are necessary to demonstrate finally whether the occurrence of widespread VCG in S. lacrymans is due to the sharing of VC alleles rather than to clonality.


    ACKNOWLEDGMENTS
 
The University of Oslo (UiO), Norway and a post-doctoral scholarship to H. Kauserud from the Research Council of Norway (Grant 147064/432) financially supported this study. The laboratory work was conducted at the Laboratory of Molecular Ecology and Evolution (DNA-lab), and the MycoLab, UiO. Thank-you to J. Stenlid, N. Högberg, T. Schumacher, A.M. Bendiksby and two anonymous reviewers for critical comments to the manuscript, N. Winger-Steen for technical assistance, K. Weierud (MegaBACE-lab, UiO) for DNA-sequencing, staff at Mycoteam AS for providing basidiocarps, C. Decock (MUCL), O. Schmidt (University of Hamburg) and G. Alfredsen (Skogforsk) for providing cultures and K. Høiland for providing digital camera.


    FOOTNOTES
 
Accepted for publication August 26, 2003.

1 Corresponding author. E-mail: haavarka{at}bio.uio.no


    LITERATURE CITED
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Colwell RK. 1997. EstimateS, version 5. Statistical estimation of species richness and shared species from samples. User’s guide and application at http://viceroy.ecb.uconn.edu/estimates.

Hallenberg N, Eriksson J. 1985. The Lachnocladiaceae and Coniophoraeceae of north Europe. Oslo, Norway: Fungiflora.

Hansen EM, Hamelin RC. 1999. Population structure of basidiomycetes. In: Worrall JJ, ed. Structure and dynamics of fungal populations. Dordrecht, The Netherlands: Kluwer Academic Publisher. p 251–281.

Hantula J, Dusabenyagasani M, Hamelin RC. 1996. Random amplified microsatellites (RAMS)—a novel method for characterizing genetic variation within fungi. European Journal of Forest Pathology 26:159–166.

Harmsen L. 1960. Taxonomic and cultural studies on brown-spored species of the genus Merulius. Friesia 6: 233–277.

Jacobson KM, Gordon TR. 1991. Fusarium oxysporum f.sp. melonis: a case study of diversity within a forma specialis. Phytopathology 81:1064–1067.

Jacobson KM, Miller OKJr, Turner BJ. 1993. Randomly amplified polymorphic DNA markers are superior to somatic incompatibility tests for discriminating genotypes in natural populations of the ectomycorrhizal fungus Suillus granulatus. Proc Natl Acad Sci USA 90:9159–9163.[Abstract/Free Full Text]

James TY, Moncalvo JM, Li S, Vilgalys R. 2001. Polymorphism at the ribosomal DNA spacers and its relation to breeding structure of the widespread mushroom Schizophyllum commune. Genetics 157:149–161.[Abstract/Free Full Text]

Kauserud H. 2001. Population genetics and sexuality in wood-decaying polypores (Basidiomycota) [Doctoral dissertation]. Oslo, Norway: University of Oslo. 130 p.

Kauserud H, Schumacher T. 2001. Outcrossing or inbreeding: DNA markers provide evidence for type of reproductive mode in Phellinus nigrolimitatus (Basidiomycota). Mycol Res 105:676–683.

Kauserud H, Schumacher T. 2002. Population structure of the endangered wood decay fungus Phellinus nigrolimitatus (Basidiomycota). Can J Bot 80:597–606.

Liu YC, Cortesi P, Double ML, MacDonald WL, Milgroom MG. 1996. Diversity and multilocus genetic structure in populations of Cryphonectria parasitica. Phytopathology 86:1344–1351.

Malik M, Vilgalys R. 1999. Somatic incompatibility in fungi. In: Worrall JJ, ed. Structure and dynamics of fungal populations. Dordrecht, The Netherlands: Kluwer Academic Publisher. p 123–138.

May G, Shaw F, Badrane H, Vekemans X. 1999. The signature of balancing selection: fungal mating compatibility gene evolution. Proc Natl Acad Sci USA 96:9172–9177.[Abstract/Free Full Text]

Milgroom MG, Brasier CM. 1997. Potential diversity in vegetative compatibility types of Ophiostoma novoulmi in North America. Mycologia 89:722–726.

Milgroom MG, Cortesi P. 1999. Analysis of population structure of the chestnut blight fungus based on vegetative incompatibility genotypes. Proc Natl Acad Sci USA 18:10518–10523.

Murray MG, Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucl Acid Res 8:4321–4325.[Abstract/Free Full Text]

Rayner ADM. 1991. The challenge of the individualistic mycelium. Mycologia 83:48–71.

Schmidt O, Moreth-Kebernik U. 1991. Monokaryon pairings of the dry rot fungus Serpula lacrymans. Mycol Res 95:1382–1386.

Stenlid J, Vasiliauskas R. 1998. Genetic diversity within and among vegetative compatibility groups of Stereum sanguinolentum determined by arbitrary primed PCR. Mol Ecol 7:1265–1274.

Thon RM, Royse DJ. 1999. Partial ß-tubulin gene sequences for evolutionary studies in the Basidiomycotina. Mycologia 91:468–474.

Vainio EJ, Hantula J. 1999. Variation of RAMS markers within the intersterility groups of Heterobasidion annosum in Europe. European Journal of Forest Pathology 29: 231–246.

Vasiliauskas R, Stenlid J. 1999. Vegetative compatibility groups of Amylostereum areolatum and A. chailletii from Sweden and Lithuania. Mycol Res 103:824–829.

Vasiliauskas R, Stenlid J, Thomsen IM. 1998. Clonality and genetic variation in Amylostereum areolatum and A. chailletii from northern Europe. New Phytol 139:751–758.

White N, Dehal PK, Duncan JM, Williams NA, Gartland JS, Palfreyman JW, Cooke DEL. 2001. Molecular analysis of intraspecific variation between building and "wild" isolates of Serpula lacrymans and their relatedness to S. himantioides. Mycol Res 105:447–452.

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols, a guide to methods and applications. San Diego, California: Academic Press. p 315–322.

Worrall JJ. 1997. Somatic incompatibility in basidiomycetes. Mycologia 89:24–36.




This article has been cited by other articles:


Home page
Appl. Environ. Microbiol.Home page
M. Tlalka, M. Fricker, and S. Watkinson
Imaging of Long-Distance {alpha}-Aminoisobutyric Acid Translocation Dynamics during Resource Capture by Serpula lacrymans
Appl. Envir. Microbiol., May 1, 2008; 74(9): 2700 - 2708.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kauserud, H.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Kauserud, H.
Agricola
Right arrow Articles by Kauserud, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS