This Article Abstract Full Text (PDF) Services Similar articles in this journal Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Denman, S. Articles by Wingfield, M. J. Search for Related Content PubMed Articles by Denman, S. Articles by Wingfield, M. J. Agricola Articles by Denman, S. Articles by Wingfield, M. J.

Circumscription of Botryosphaeria species associated with Proteaceae based on morphology and DNA sequence data

     Department of Plant Pathology, University of Stellenbosch, P. Bag X1, Matieland 7602, South Africa

Bernard Slippers
Brenda D. Wingfield
Michael J. Wingfield

     Departments of Genetics, Microbiology and Plant Pathology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria 0002, South Africa

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS TAXONOMY DISCUSSION LITERATURE CITED

 

Botryosphaeria spp. occur on and cause diseases of Proteaceae, but accurate identification has been problematic due to the lack of clear species circumscriptions of members of this genus. In this study, 46 isolates of Botryosphaeria from proteaceous hosts growing in various parts of the world were studied, using morphology, cultural characters and sequence data from the ITS region of the rDNA operon. Five Botryosphaeria spp. were found to be associated with Proteaceae. Botryosphaeria lutea was isolated from Banksia and Buckinghamia spp. in Australia, and a single isolate was obtained from Protea cynaroides in South Africa. Botryosphaeria proteae was associated only with South African Proteaceae, but occurred in many parts of the world. Another Botryosphaeria sp. that occurred exclusively on South African Proteaceae represents a new taxon that is described as B. protearum. This pathogen was found on South African Proteaceae cultivated in Australia; Hawaii; Portugal, including the Madeira Islands; and South Africa. Botryosphaeria ribis was associated with both South African and Australian Proteaceae and was isolated from material collected in Australia, Hawaii and Zimbabwe. A single occurrence of B. obtusa as an endophyte was recorded from P. magnifica in South Africa. In addition to providing a taxonomic overview of Botryosphaeria spp. associated with Proteaceae, this paper clarifies for the first time the global distribution of these species. A key also is provided to facilitate their identification. A large number of new host and distribution records are made and a new species of Botryosphaeria from Proteaceae is described.

Key words: Botryosphaeria protearum, Fusicoccum protearum, ITS, key, systematics

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS TAXONOMY DISCUSSION LITERATURE CITED

 
Members of the plant family Proteaceae are indigenous to Australia, Central America, South Africa, South America, Southeast Asia and southwestern Pacific islands (Rebelo 1995). Proteaceae as cut flowers are valued in international markets. Consequently, certain species increasingly are being cultivated because global trade in fresh-cut flower proteas, as well as germplasm (in the form of seed and rooted cuttings), is growing. Many South African Proteaceae (e.g., Leucadendron, Leucospermum and Protea) are cultivated in Australia, Chile, Israel, New Zealand, Portugal (on the mainland and Azores and Madeira islands), Spain (on the mainland and Canary Islands), USA (California, Hawaii), and Zimbabwe. Similarly, some Australian Proteaceae (e.g., Banksia and Telopea spp.), are cultivated in countries other than Australia (Crous et al 2000b).

One of the factors limiting commercial production of Proteaceae is damage caused by pests and diseases (Knox-Davies 1981, Wright and Saunderson 1995). Some pathogens cause significant losses in the field and in nurseries. Others damage the appearance of blooms, and, although they are not debilitating pathogens, they are considered important for aesthetic reasons. Many pathogens associated with Proteaceae are regarded as actionable quarantine organisms, and the presence of these organisms in export shipments can result in rejection of consignments at the point of entry due to contravention of phytosanitary regulations (Crous et al 2000c, Taylor 2001).

Among the most important fungal pathogens of Proteaceae are Botryosphaeria spp., causing leaf spot and necrosis, shoot dieback, stem cankers and plant death (Knox-Davies 1981, Knox-Davies et al 1986). Recently it has been demonstrated that some Botryosphaeria spp. have an endophytic or a latent phase in their life cycles (Smith et al 1996, Swart et al 2000). This could facilitate the inadvertent introduction of pathogens into new areas, which also might threaten agriculture and indigenous vegetation in these regions. A number of fungal pathogens that occur on Proteaceae already have been introduced into other countries in this way (Crous et al 2000c).

Diseases caused by Botryosphaeria spp. have been recorded in most areas where Proteaceae are cultivated (Olivier 1951, van Wyk 1973, Benic and Knox-Davies 1983, von Broembsen 1986, Orffer and Knox-Davies 1989, Serfontein and Knox-Davies 1990, Forsberg 1993, Moura and Rodrigues 2001, Taylor et al 2001a, b). However, the species involved are often unidentified or subject to controversy largely due to the lack of clear species circumscription of members of this genus (Shoemaker 1964, Laundon 1973, Morgan-Jones and White 1987, Jacobs and Rehner 1998, Denman et al 2000). With the re-evaluation of morphological features of Botryosphaeria spp. (Crous and Palm 1999) and recent advances in molecular taxonomy, many of these problems now can be resolved (Jacobs and Rehner 1998, Denman et al 2000, Zhou et al 2001).

Correct identification of Botryosphaeria spp. associated with Proteaceae, cultivated in both Northern and Southern hemispheres, would make it possible to monitor global movement of these pathogens. It also would contribute to appropriate application of quarantine decisions. Moreover, accurate species identities are required to develop appropriate disease management strategies, because species of Botryosphaeria differ in their interactions with different hosts and environmental conditions (Britton and Hendrix 1982, 1986).

The aim of this study was to establish the identity of the Botryosphaeria spp. isolated from Proteaceae growing in different parts of the world. A table listing the different Botryosphaeria spp. and their proteaceous hosts were compiled (Table I), and a key to Botryosphaeria spp. associated with Proteaceae provided.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS TAXONOMY DISCUSSION LITERATURE CITED

Sequence comparisons – Forty-six isolates (Table II) were sequenced. Methods for DNA extraction described by Crous et al (2000a) were followed. The primers ITS1 (5'TTTCCGTAGGTGAACCTGC3') and ITS4 (5'TCCTCCGCTTATTGATATGC') (White et al 1990) were used to amplify part of the nuclear rRNA operon, using polymerase chain reaction (PCR). The amplified region included the 3' end of the 16S (small subunit) rDNA gene, the first internal transcribed spacer (ITS1), the 5.8S rDNA gene, the second ITS (ITS2) region and the 5' end of the 26S (large subunit) of the rDNA gene. PCR products were purified according to the manufacturer's instructions with a commercial kit (Nucleospin Extract 2 in 1 Purification Kit, Machery-Nagel GmbH & Co., Germany). Sequencing reactions were carried out with ABI PRISM Big Dye Terminator Cycle v3.0 Sequencing Ready Reaction Kit (PE Biosystems, Foster City, California, USA) according to the manufacturer's recommendations. The reaction was done on an ABI Prism 377 DNA Sequencer (Perkin-Elmer, Norwalk, Connecticut, USA).

Raw sequence data were analyzed with EditView 1.0.1 (http://www.appliedbiosystems.com) and manually aligned by inserting gaps. Phylogenetic analyses were undertaken with PAUP (Phylogenetic Analysis Using Parsimony) version 4.0b8 (Swofford 2000). Gaps were treated as a fifth character and all characters were unordered and of equal weight. The data matrix consisted of two outgroup taxa and 61 ingroup taxa, each sequence containing 528 characters (including gaps). Heuristic searches were carried out with stepwise simple addition and tree bisection and reconstruction (TBR) as the branch-swapping algorithm to find maximum-parsimony trees. Branches of zero length were collapsed and all multiple, equally parsimonious trees were saved. Branch support was determined with 1000 bootstrap replicates (Felsenstein 1985).

Representative Botryosphaeria sequences from the preliminary clades were used to obtain sequences from GenBank with a standard nucleotide-nucleotide BLAST search (Altschul et al 1997). The representative sequences from GenBank [AF27741 (B. ribis), AF293480 and AF27745 (B. lutea), AF27759 (B. obtusa), AF241175 (B. dothidea) Table II] were included in the analyses. The sequences of 10 Botryosphaeria isolates from Proteaceae in a previous study (Denman et al 2000) also were included in the analyses (Table II). Trees were rooted to Mycosphaerella africana Crous & M.J. Wingf. (AF 283690) and Guignardia bidwellii (Ellis) Viala & Ravaz (AF 216533), which have been shown to be useful outgroup taxa (Denman 2002).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS TAXONOMY DISCUSSION LITERATURE CITED

 
Sequence comparisons – PCR products of ca 580 base pairs (bp) were obtained for the 46 isolates (Table II). Of these, 51 variable characters were parsimony uninformative and 208 were parsimony informative and used to obtain 159 most parsimonious trees of 470 steps, using heuristic searches (CI = 0.821, RI = 0.952, RC = 0.782) (Fig. 1). Sequence data of isolates were deposited in GenBank (Table II) and the alignment in TreeBase (S779; M1234).

View larger version (30K): [in this window] [in a new window]    FIG. 1. The phylogram of one of the 159 most-parsimonious trees derived from the alignment of ITS1 5.8S rDNA and ITS2 sequence data of Botryosphaeria isolates from Proteaceae. The topology of the different trees differed only in the arrangements of isolates within the identified clades, not between them. The tree is rooted to Mycosphaerella africana Crous & M.J. Wingf. and Guignardia bidwellii (Ellis) Viala & Ravaz. Branch support is given above the branches based on 1000 bootstrap replicates. The bar represents 10 changes

Twenty of the isolates formed a separate, strongly supported clade (100% bootstrap support). This clade was clearly distinct from those of any other species of Botryosphaeria and is considered a new taxon. Previously, representative sequences from this clade had been reported to form part of Botryosphaeria dothidea (Moug : Fr.) Ces. & De Not. complex (Denman et al 2000). However, results of this study show that this group is closer to B. ribis than to B. dothidea but is clearly separate from both.

No isolates of B. ribis were found in the material from South Africa or Madeira Islands. All but one of the F. luteum isolates were from Australian Proteaceae (Banksia L.f. and Buckinghamia F.Muell.), growing in Australia (Table II). The single F. luteum isolate (STE-U4393), which was not obtained from Australia, occurred as an endophyte on Protea cynaroides L. in South Africa (Table II).

All isolates of the unidentified Botryosphaeria sp., which we believe represents a new taxon, were from South African Proteaceae. However, they were obtained from many parts of the world, including Australia, Madeira Islands, Portugal, and South Africa (Table I). Similarly, B. proteae was restricted to South African Proteaceae, but was present in many countries, including Australia, Hawaii (USA) and Portugal. The single isolate of B. obtusa was obtained from a wild Protea sp. in a nature reserve in South Africa.

	TAXONOMY

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS TAXONOMY DISCUSSION LITERATURE CITED

 

Botryosphaeria protearum Denman & Crous, sp. nov. Figs. 2–14

View larger version (61K): [in this window] [in a new window]   FIG. 2. Asci, ascospores and pseudoparaphyses of Botryosphaeria protearum. Bar = 10 µm.

View larger version (79K): [in this window] [in a new window]   FIGS. 3–4. Fusicoccum protearum. 3. Conidia and conidiophores. 4. Spermatia and spermatiophores. Bar = 10 µm.

View larger version (146K): [in this window] [in a new window]    FIGS. 5–14. Botryosphaeria protearum and its anamorph Fusicoccum protearum. 5. Vertical section through a pseudothecium. 6, 7. Asci and ascospores. 8. Ascus with apical chamber (arrowed). 9, 10. Ascospores. 11. Pseudoparaphyses. 12. Conidiophores. 13. Vertical section through a pycnidium. 14. Conidia. Bars = 10 µm

Ascomata in contextu hospitis inclusa, usque ad 600 µm diametro, erumpescentia, solitaria, botryosa, stromatiformia, atrobrunnea vel nigra, cum ostiolis centralibus nigris. Asci clavati ad subcylindricati, inter paraphyses filiformes interspersi, 110–200 x 15–21 µm, octosporati, bitunicati. Ascosporae irregulariter biseriatae, hyalinae, unicellulares, granulares, cum aetate pallide brunnescens, (25–)26–33(–37) x (9–)10–12(–13) µm, juventute inaequilaterae, fusiformes, medio latissimae.

Pycnidia in contextu hospitis inclusa, solitaria vel botryosa, stromatiformia, globosa, usque ad 500 µm diametro; paries pycnidii e stratis 4–8 formata, e textura angulari brunnea composita, ad intima hyalinescens. Cellulae conidiogenae holoblasticae, hyalinae, subcylindricae, 7–12 x 3–5 µm, percurrenter cum 1–2 proliferationibus prolificentes, vel in plano eodem periclinaliter minuter incrassatae. Conidia hyalina, granularia, ovoidea vel clavata vel fusoidea, (20–)25–30(–40) x 7–8(–10) µm.

Ascomata pseudothecial, embedded in host tissue, up to 600 µm diam, becoming erumpent, solitary or botryose, stromatic, dark brown to black, with central, black ostioles; pseudothecial wall 6–15 cell layers thick, composed of brown textura angularis. Asci clavate to subcylindrical, 110–200 x 15–21 µm, 8-spored, bitunicate with a well-developed apical chamber that becomes inconspicuous at maturity. Pseudoparaphyses filiform, branched, septate, 3–5 µm wide. Ascospores irregularly biseriate, hyaline, nonseptate, granular, becoming light brown with age, (25–)26–33(–37) x (9–)10–12(–13) µm, fusiform, widest in the middle with obtuse ends, sometimes inequilateral.

Pycnidia embedded in host tissue, solitary or botryose, stromatic, globose, up to 500 µm diam, pycnidial wall 4–8 cell layers thick, composed of brown textura angularis, becoming hyaline towards the inner region. Conidiophores 0–1-septate, hyaline, subcylindrical, rarely branched, 7–20 (–30) x 3–5 µm. Conidiogenous cells holoblastic, hyaline, subcylindrical, 7–12 x 3–5 µm, rarely proliferating percurrently with 1–2 proliferations, proliferating predominantly at the same level with minute (inconspicuous) periclinal thickening, which becomes more prominent in older conidiogenous cells. Conidia hyaline, granular, ovoid to clavate when young, becoming irregularly fusoid when mature, widest in the middle with an obtuse apex and bluntly rounded or slightly flattened base (inconspicuous in older, permanent mounts), (20–)25–30(–40) x 7–8(–10) µm in vivo. Spermatial state produced in conidiomata with the Fusicoccum anamorph, or in separate spermatogonia. Spermatiophores hyaline, smooth, branched, cylindrical, 0–2-septate, straight, unbranched or branched above, 12–17 x 2–3 µm. Spermatiogenous cells discrete or integrated, hyaline, smooth, cylindrical, proliferating via determinate phialides with periclinal thickening, 5–12 x 1.5–2.5 µm. Spermatia hyaline, smooth, aseptate, rod-shaped with rounded ends, 3–6 x 1–1.5 µm. Cultures producing colonies that are initially translucent to white, gradually darkening from the center, olive green to gray after 4–7 d, becoming charcoal black after 14–21 d. Initially forming aerial mycelium which eventually resulting in flat colonies with rims of loose aerial mycelium at the edge of the dish. Colony color, based on the color charts of Rayner (1970) was greenish black (33^{’’’’’}k) underneath and olivaceous gray (23^{’’’’’}i) to iron gray (25^{’’’’’}k) on the surface. Aerial mycelium at the edge of the dish smoke gray (21^’’’’f) to pale olivaceous gray (21^{’’’’’}f). Black conidiomatal initials sometimes were formed, beginning in the center of colonies and spreading over the entire colony surface. Sporulation not observed in vitro. Cardinal temperatures for growth were min below 5 C, opt 25 C, max above 35 C, no growth at 40 C. The mean daily growth rate at 25 C was 25.5 mm/d (Fig. 15)

View larger version (16K): [in this window] [in a new window]    FIG. 15. Temperature-growth relationship of B. protearum cultured on PDA for 4 d

Hosts. Protea compacta x P. susannae cv. Pink Ice, P. cynaroides, P. eximia, P. magnifica, P. neriifolia R. Br., P. repens (L.) L., Leucadendron salignum x L. laureolum cv. Silvan Red, L. tinctum I. Williams and other Leucadendron spp.

Known distribution. Australia (Queensland); Madeira Islands, Portugal; Portugal; South Africa (Western Cape Province) (Table I).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS TAXONOMY DISCUSSION LITERATURE CITED

 
This study represents the first comprehensive characterization of the species of Botryosphaeria associated with Proteaceae and provides a foundation for future pathological and biogeographical studies of these fungi. Fusicoccum luteum is newly reported on Australian Proteaceae (Buckinghamia) in Australia and on P. cynaroides in South Africa. Zhou and Stanosz (2001) also reported an isolate from Banksia in Australia, misidentified as B. ribis, to be representative of F. luteum. Results of this study confirm the presence of F. luteum on Banksia and extend the host range to Buckinghamia. Shearer et al (1995) described a devastating disease of Banksia coccinea R. Brown caused by B. ribis on the southwestern coast of Australia. In light of the findings by Zhou and Stanosz (2001) and results of this work, it seems likely that the pathogen described by Shearer et al (1995) is F. luteum. It also appears that F. luteum is widely distributed on Australian Proteaceae.

The single collection of F. luteum on Proteaceae in South Africa probably is not representative of the relative occurrence of this fungus on Proteaceae in the country. This view is based on the fact that the fungus appears to be common on Proteaceae in Australia and on kiwifruit, apple and pear in New Zealand (Pennycook and Samuels 1985). Fusicoccum luteum has been found commonly on grapevines in Portugal by Phillips et al (2002), who recently described the teleomorph of this fungus as Botryosphaeria lutea A.J.L. Phillips. In the Western Cape Province of South Africa, this fungus also has been commonly associated with grapevines as well as stone and pome fruit trees, which are cultivated alongside Proteaceae orchards (P.W. Crous unpubl). Fusicoccum luteum was isolated as an endophyte of P. cynaroides and thus cannot be viewed as a pathogen of South African Proteaceae. This isolate formed its teleomorph in culture, a feature not previously recorded for this fungus.

The newly described Botryosphaeria protearum was found on South African Proteaceae in their native habitat, as well as other areas where these plants are cultivated. It also is reported for the first time from Australia, Madeira Islands, Portugal and South Africa. The exclusive association with South African Proteaceae suggests that B. protearum is indigenous to South Africa and most likely was introduced into other countries on South African protea germplasm. In this paper the anamorph of B. protearum (Fusicoccum protearum) has been named because the taxonomy of Botryosphaeria largely is dependent on its anamorphs, and it is usually the anamorph that is encountered (Hanlin 1990).

The family Proteaceae comprises two subfamilies, namely the Proteoideae and the Grevilleoideae. Members of the former occur mainly in southern Africa while members of the latter group occur primarily in Australia (Rebelo 1995). Current results, as well as those from previous studies (Crous et al 2000c, Taylor et al 2001a, b), confirm that B. proteae is associated with only South African Proteaceae. Both B. protearum and B. proteae, therefore, seem to be specific at subfamily level to South African Proteoideae. The results of this study support those of Crous et al (2000c) and Taylor et al (2001a, b), who suggested that many of the fungal pathogens of Proteaceae are host specific.

This is the first report of B. ribis from South African and Australian Proteaceae cultivated in Hawaii and from P. cynaroides in Zimbabwe. This pathogen has been reported from Grevillea robusta Cunn. in Gautamala (Schieber and Zentmeyer 1978) and in South Africa from Leucadendron R.Br. (Olivier 1951). However, in view of the confusion about the identity of B. ribis (Witcher and Clayton 1963, Maas and Uecker 1984, Rumbos 1987, Rayachhetry et al 1996, Zhou and Stanosz 2001, Zhou et al 2001), earlier reports must be interpreted with some circumspection. In this study Botryosphaeria ribis was not found on Proteaceae in South Africa, despite previous reports to the contrary (Olivier 1951, Crous et al 2000b). The South African samples included in this work were collected from Proteaceae in the cool, winter rainfall region in Western Cape Province, which could explain the absence of B. ribis from these samples. Previous records of B. ribis from various hosts in South Africa show that the hosts were growing in warm, humid climates (Schieber and Zentmeyer 1978, Herbert and Grech 1985, Crous et al 2000b). This suggests that warm, humid climatic conditions might be a prerequisite for infection by this pathogen. Further evidence supporting this hypothesis is presented in this study, where B. ribis occurred only on Proteaceae in Australia (Queensland), Hawaii and Zimbabwe, which are areas with high temperature and humidity. In South Africa, the cultivation of Proteaceae is expanding into the warm, humid, summer rainfall regions, and this might lead to the appearance of B. ribis on Proteaceae in South Africa.

The isolated incidence of B. obtusa on P. magnifica is difficult to explain. This fungus, however, has been commonly isolated from apples (Stevens and Jenkins 1924), a host that is cultivated close to the Groot Winterhoek Nature Reserve where this sample was collected. Wider sampling might reveal broader distribution of this fungus on Proteaceae.

This study has clarified the current global distribution of Botryosphaeria spp. associated with Proteaceae. A key to identify the taxa associated with Proteaceae is thus provided to alleviate taxonomic confusion.

KEY TO BOTRYOSPHAERIA SPP. ASSOCIATED WITH PROTEACEAE

1. Conidia pigmented at maturity . . . . . 2

1. Conidia hyaline at maturity . . . . . 3

     2. Conidia sienna brown at maturity, ovoid to subcylindric with truncate base and obtuse apex, 20–26 x 9–12 µm, 0(–1)-septate, walls warty or finely roughened, 0.5–1 µm thick, synanamorph absent; ascospores hyaline, broadly fusiform, widest in the middle, granular, smooth, 25–33 x 7–12 µm; colony with moderate to rapid growth rate (>40 mm/wk on PDA at 25 C) colony margins smooth and uniform, gray-brown . . . . . B. obtusa

     2. Conidia medium brown, subcylindrical, 7–14 x 2.5–3.5 µm, aseptate, walls finely verruculose; synanamorph: conidia hyaline, fusiform, 20–30 x 4.5–6 µm; ascospores hyaline, ellipsoidal, clavate–fusiform, frequently widest in the upper one third of the ascospore, tapering to obtuse ends, guttulate, smooth, 15–21 x 5–9 µm; colony slow growing (<40 mm/wk on PDA at 25 C), colony margins crenate to irregular, occasionally sectored, buff to iron gray . . . . . B. proteae

3. Colony slow growing (<40 mm/wk on PDA at 25 C); conidia fusiform, 20–30 x 4.5–6 µm, aseptate, walls smooth; synanamorph: conidia medium brown, subcylindrical, 7–14 x 2.5–3.5 µm, aseptate, walls finely verruculose; ascospores hyaline, ellipsoidal, clavate–fusiform, frequently widest in the upper one third of the ascospore, tapering to obtuse ends, guttulate, smooth, 15–21 x 5–9 µm; colony slow growing (<40 mm/wk), colony margins crenate to irregular, mycelium moderate, occasionally sectored, buff to iron gray . . . . . B. proteae

3. Colony growth fast (>90 mm/wk on PDA at 25 C) . . . . . 4

     4. Colonies producing a yellow pigment in young cultures; conidia fusiform–ellipsoidal, base truncate or bluntly rounded, 14–32 x 4.5–9 µm, aseptate, walls smooth; synanamorph absent; ascospores hyaline, guttulate, smooth, oval to broadly fusiform, widest in the upper one third of the ascospore, tapering to obtuse base and apex, 18–28.5 x 7.5–12 µm; colony rapid growing (>90 mm/wk on PDA at 25 C) colony margins smooth and uniform, mycelium moderate, gray to dark gray . . . . . B. lutea

     4. Colonies not producing yellow pigment in culture . . . . . 5

5. Conidia on average <25 µm in length, ovoid, apex rounded, base tapered, 17–24 x 7–11 µm; ascospores hyaline, ovoid, widest in the upper one third of the ascospore 17–28 x 7–12 µm; mycelium thick, woolly, gray (14–21 d on PDA at 25 C) . . . . . B. ribis

5. Conidia on average >25 µm in length, irregularly fusoid, apex obtuse, base bluntly rounded, 20–40 x 9–13 µm; ascospores hyaline, becoming light brown with age, fusiform, widest in the middle with obtuse ends, sometimes inequilateral, 25–37 x 9–13 µm; mycelium flattened in the center, with a rim of loose aerial mycelium at the edge of the dish (14–21 d on PDA at 25 C) . . . . . B. protearum

	ACKNOWLEDGMENTS

 
The authors acknowledge the South African Protea Producers and Exporters Association (SAPPEX) and the South African National Research Foundation (NRF) for financial support.

	FOOTNOTES

 
¹ Corresponding author, crous{at}cbs.knaw.nl

Accepted for publication August 31, 2002.

	LITERATURE CITED

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS TAXONOMY DISCUSSION LITERATURE CITED

 
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller D, Lipman DJ., 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl Acids Res 25:3389-3402[Abstract/Free Full Text]

Benic LM, Knox-Davies PS., 1983 Anthracnose of Protea compacta, caused by Colletotrichum gloeosporioides. Phytophylactica 15:109-119

Britton KO, Hendrix FF., 1982 Three species of Botryosphaeria cause peachtree gummosis in Georgia. Pl Dis 66:1120-1121

———, ———. 1986 Population dynamics of Botryosphaeria spp. in peach gummosis cankers. Pl Dis 70:134-136

Crous PW, Aptroot A, Kang J-C, Braun U, Wingfield MJ., 2000a The genus Mycosphaerella and its anamorphs. Stud Mycol 45:107-121

———, Hong L, Wingfield BD, Wingfield MJ., 2001 ITS rDNA phylogeny of selected Mycosphaerella spp. and their anamorphs occurring on Myrtaceae. Mycol Res 105:425-431

———, Palm ME., 1999 Reassessment of the anamorph genera Botryodiplodia, Dothiorella and Fusicoccum. Sydowia 51:167-175

———, Phillips AJL, Baxter AP., 2000b Phytopathogenic fungi from South Africa. Stellenbosch, South Africa: Department of Plant Pathology Press. 358 p

———, Summerell BA, Taylor JE, Bullock S., 2000c Fungi occurring on Proteaceae in Australia: selected foliicolous species. Austral Pl Pathol 29:267-278

Denman S., 2002 Botryosphaeria diseases of Proteaceae. [PhD Dissertation]. South Africa: University of Stellenbosch. 159 p

———, Crous PW, Taylor JE, Kang J-C, Pascoe I, Wingfield MJ., 2000 An overview of the taxonomic history of Botryosphaeria, and a re-evaluation of its anamorphs based on morphology and ITS rDNA phylogeny. Stud Mycol 45:129-140

———, ———, Wingfield MJ., 1999 A taxonomic reassessment of Phyllachora proteae, a leaf pathogen of Proteaceae. Mycologia 91:510-516

Felsenstein J., 1985 Confidence intervals on phylogenetics: an approach using bootstrap. Evolution 39:783-791

Fisher NL, Burgess LW, Toussoun TA, Nelson PE., 1982 Carnation leaves as substrate and for preserving cultures of Fusarium species. Phytopathology 72:151-153

Forsberg L., 1993 Protea diseases and their control. Brisbane, Australia: Queensland Government, Department of Primary Industries. 13 p

Hanlin RT., 1990 Illustrated Genera of Ascomycetes. St. Paul, Minnesota, USA: APS Press. 263 p

Hansford CG., 1954 Australian fungi. II. New records and revisions. Proc Linn Soc New South Wales 79:97-164

Herbert JA, Grech NM., 1985 Branch dieback of macadamias in South Africa induced by Botryosphaeria ribis. Pl Dis 69:83.

Jacobs KA, Rehner SA., 1998 Comparison of cultural and morphological characters and ITS sequences in anamorphs of Botryosphaeria and related taxa. Mycologia 90:601-610

Knox-Davies PS., 1981 Comments on fungus diseases of plants indigenous to the South-Western Cape. Veld & Flora 67:88-91

———, van Wyk PS, Marasas WFO., 1986 Diseases of proteas and their control in the South-Western Cape. Acta Hort 185:189-200

Laundon GF., 1973 Botryosphaeria obtusa, B. stevensii, and Otthia spiraeae in New Zealand. Trans Br Mycol Soc 61:369-374

Maas JL, Uecker FA., 1984 Botryosphaeria dothidea cane canker of thornless blackberry. Pl Dis 68:720-726

Morgan-Jones G, White JFJr., 1987 Notes on Coelomycetes II. Concerning the Fusicoccum anamorph of Botryosphaeria ribis. Mycotaxon 30:117-125

Moura MF, Rodrigues PF., 2001 Fungal diseases on proteas identified in Madeira Islands. Acta Hort 545:265-268

Olivier D., 1951 Progress in the study of the silver-tree disease. J Bot Soc South Africa 37:18-19

Orffer S, Knox-Davies PS., 1989 A canker and die-back disease of Protea repens. Phytophylactica 21:189-194

Pennycook SR, Samuels GJ., 1985 Botryosphaeria and Fusicoccum species associated with ripe fruit rot of Actinidia deliciosa (kiwifruit) in New Zealand. Mycotaxon 24:445-458

Petrak VF., 1967 Über eine neue Botryosphaeria-Art der australischen Flora. Sydowia 21:235-239

Phillips AJL, Fonseca F, Povoa V, Castilho R, Nolasco G., 2002 A reassessment of the anamorphic fungus Fusicoccum luteum and description of its teleomorph Botryosphaeria lutea sp. nov. Sydowia 54:59-77

Rayner RW., 1970 A mycological color chart. Kew, Surrey, UK: CMI and British Mycological Society. 17 sheets, 34 p.

Rayachhetry MB, Blakeslee GM, Webb RS, Kimbrough JW., 1996 Characteristics of the Fusicoccum anamorph of Botryosphaeria ribis, a potential biological control agent for Melaleuca quinquenervia in south Florida. Mycologia 88:239-248

Rebelo T., 1995 Proteas: A field guide to the proteas of Southern Africa. Singapore: Tien Wah Press. 224 p

Rumbos IC., 1987 Twig and branch dieback of walnut trees induced by Botryosphaeria ribis. Pl Pathol 36:602-605

Schieber E, Zentmeyer GA., 1978 An important canker disease of Grevillea in Guatemala. Pl Dis Reporter 62:923-924

Serfontein S, Knox-Davies PS., 1990 Leaf spot of Protea magnifica and copper leaf of Leucospermum cordifolium associated with Coleroa senniana. Phytophylactica 22:103-107

Shearer BL, Fairman RG, Bathgate JA., 1995 Cryptodiaporthe melanocraspeda canker as a threat to Banksia coccinea on the south coast of Western Australia. Pl Dis 79:637-641

Shoemaker RA., 1964 Conidial states of some Botryosphaeria species on Vitis and Quercus. Can J Bot 42:1297-1303

Smith H, Wingfield MJ, Crous PW, Coutinho TA., 1996 Sphaeropsis sapinea and Botryosphaeria dothidea endophytic in Pinus spp. and Eucalyptus spp. in South Africa. S African J Bot 62:86-88

Stevens NE, Jenkins AE., 1924 Occurrence of the currant cane blight fungus on other hosts. J Agric Res 27:837-844

Swart L, Crous PW, Petrini O, Taylor JE., 2000 Fungal endophytes of Proteaceae, with particular emphasis on Botryosphaeria proteae. Mycoscience 41:123-127

Swofford DL., 2000 PAUP. Phylogenetic analysis using parsimony (and other methods) version 4. Sunderland, Massachusetts, USA: Sinauer Associates

Taylor JE., 2001 Proteaceae pathogens: the significance of their distribution in relation to recent changes in phytosanitary regulations. Acta Hort 545:253-264

———, Crous PW, Swart L., 2001a Foliicolous and caulicolous fungi associated with Proteaceae cultivated in California. Mycotaxon 78:75-103

———, ———, Palm ME., 2001b Foliar and stem fungal pathogens associated with Proteaceae in Hawaii. Mycotaxon 78:449-490

van Wyk PS., 1973 Funguspatogene van die genera Protea, Leucadendron en Leucospermum met spesiale verwysing na Phytophthora cinnamomi. [PhD Dissertation]. Stellenbosch, South Africa: University of Stellenbosch. 86 p.

von Broembsen SL., 1986 Blight of pincushions (Leucospermum spp.) caused by Drechslera dematioidea. Pl Dis 70:33-36

White TJ, Bruns TD, Lee S, Taylor JW., 1990 Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. New York: Academic Press. p 315–322

Witcher W, Clayton CN., 1963 Blueberry stem blight caused by Botryosphaeria dothidea (B. ribis). Phytopathology 53:705-712

Wright MG, Saunderson MD., 1995 Protea plant protection: from the African context to the international arena. Acta Hort 387:129-139

Zhou S, Stanosz GR., 2001 Relationships among Botryosphaeria species and associated anamorphic fungi inferred from the analyses of ITS and 5.8S rDNA sequences. Mycologia 93:516-520

———, Smith DR, Stanosz GR., 2001 Differentiation of Botryosphaeria species and related anamorphic fungi using inter simple or short sequence repeat (ISSR) fingerprinting. Mycol Res 105:919-926

This article has been cited by other articles:

				U. Damm, P. W. Crous, and P. H. Fourie Botryosphaeriaceae as potential pathogens of prunus species in South Africa, with descriptions of Diplodia africana and Lasiodiplodia plurivora sp. nov. Mycologia, September 1, 2007; 99(5): 664 - 680. [Abstract] [Full Text] [PDF]

				P. W. Crous, I. H. Rong, A. Wood, S. Lee, H. Glen, W. Botha, B. Slippers, W. Z. de Beer, M. J. Wingfield, and D. L. Hawksworth How many species of fungi are there at the tip of Africa? Stud Mycol, January 1, 2006; 55: 13 - 33. [Abstract] [Full Text] [PDF]

				D. F. Farr, M. Elliott, A. Y. Rossman, and R. L. Edmonds Fusicoccum arbuti sp. nov. causing cankers on Pacific madrone in western North America with notes on Fusicoccum dimidiatum, the correct name for Scytalidium dimidiatum and Nattrassia mangiferae Mycologia, May 1, 2005; 97(3): 730 - 741. [Abstract] [Full Text] [PDF]

				A. Phillips, A. Alves, A. Correia, and J. Luque Two new species of Botryosphaeria with brown, 1-septate ascospores and Dothiorella anamorphs Mycologia, March 1, 2005; 97(2): 513 - 529. [Abstract] [Full Text] [PDF]

				B. Slippers, G. I. Johnson, P. W. Crous, T. A. Coutinho, B. D. Wingfield, and M. J. Wingfield Phylogenetic and morphological re-evaluation of the Botryosphaeria species causing diseases of Mangifera indica Mycologia, January 1, 2005; 97(1): 99 - 110. [Abstract] [Full Text] [PDF]

				B. Slippers, G. Fourie, P. W. Crous, T. A. Coutinho, B. D. Wingfield, and M. J. Wingfield Multiple gene sequences delimit Botryosphaeria australis sp. nov. from B. lutea Mycologia, September 1, 2004; 96(5): 1030 - 1041. [Abstract] [Full Text] [PDF]

				J. M. van Niekerk, P. W. Crous, J. Z. (E. Groenewald, P. H. Fourie, and F. Halleen DNA phylogeny, morphology and pathogenicity of Botryosphaeria species on grapevines Mycologia, July 1, 2004; 96(4): 781 - 798. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Services Similar articles in this journal Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Denman, S. Articles by Wingfield, M. J. Search for Related Content PubMed Articles by Denman, S. Articles by Wingfield, M. J. Agricola Articles by Denman, S. Articles by Wingfield, M. J.