Mycologia
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adams, G. C.
Right arrow Articles by Iezzoni, A. F.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Adams, G. C.
Right arrow Articles by Iezzoni, A. F.
Agricola
Right arrow Articles by Adams, G. C.
Right arrow Articles by Iezzoni, A. F.
Mycologia, 94(6), 2002, pp. 947-967.
© 2002 by The Mycological Society of America

Ribosomal DNA sequence divergence and group I introns within the Leucostoma species L. cinctum, L. persoonii, and L. parapersoonii sp. nov., ascomycetes that cause Cytospora canker of fruit trees


Gerard C. Adams 1
Rupa S. Surve-Iyer

     Department of Plant Pathology, Michigan State University, East Lansing, Michigan 48824-1312

Amy F. Iezzoni

     Department of Horticulture, Michigan State University, East Lansing, Michigan 48824-1312

    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 

Leucostoma species that are the causal agents of Cytospora canker of stone and pome fruit trees were studied in detail. DNA sequence of the internal transcribed spacer regions and the 5.8S of the nuclear ribosomal DNA operon (ITS rDNA) supplied sufficient characters to assess the phylogenetic relationships among species of Leucostoma, Valsa, Valsella, and related anamorphs in Cytospora. Parsimony analysis of the aligned sequence divided Cytospora isolates from fruit trees into clades that generally agreed with the morphological species concepts, and with some of the phenetic groupings (PG 1–6) identified previously by isozyme analysis and cultural characteristics. Phylogenetic analysis inferred that isolates of L. persoonii formed two well-resolved clades distinct from isolates of L. cinctum. Phylogenetic analysis of the ITS rDNA, isozyme analysis, and cultural characteristics supported the inference that L. persoonii groups PG 2 and PG 3 were populations of a new species apparently more genetically different from L. persoonii PG 1 than from isolates representative of L. massariana, L. niveum, L. translucens, and Valsella melastoma. The new species, L. parapersoonii, was described. A diverse collection of isolates of L. cinctum, L. persoonii, and L. parapersoonii were examined for genetic variation using restriction fragment length polymorphism (RFLP) analysis of the ITS rDNA and the five prime end of the large subunit of the rDNA (LSU rDNA). HinfI and HpaII endonucleases were each useful in dividing the Leucostoma isolates into RFLP profiles corresponding to the isozyme phenetic groups, PG 1–6. RFLP analysis was more effective than isozyme analysis in uncovering variation among isolates of L. persoonii PG 1, but less effective within L. cinctum populations. Isolates representative of seven of the L. persoonii formae speciales proposed by G. Défago in 1935 were found to be genetically diverse isolates of PG 1. Two large insertions, 415 and 309 nucleotides long, in the small subunit (SSU) of the nuclear rDNA of L. cinctum were identified as Group 1 introns; intron 1 at position 943 and intron 2 at position 1199. The two introns were found to be consistently present in isolates of L. cinctum PG 4 and PG 5 and absent from L. cinctum PG 6 isolates, despite the similarity of the ITS sequence and teleomorph morphology. Intron 1 was of subgroup 1C1 whereas intron 2 was of an unknown subgroup. RFLP patterns and presence/absence of introns were useful characters for expediting the identification of cultures of Leucostoma isolated from stone and pome fruit cankers. RFLP patterns from 13 endonucleases provided an effective method for selecting an array of diverse PG 1 isolates useful in screening plant germplasm for disease-resistance.

Key words: Ascomycota, Cytospora, ITS rDNA, Leucostoma cincta, LSU rDNA, perennial canker, phylogeny, Prunus persica, RFLP, SSU rDNA, Valsa


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 
Cytospora canker occurs on more than 60 genera of hardwood and conifer trees (Grove 1935Citation). Approximately 500 species of Cytospora Ehrenb. : Fr. have been described as causal agents of canker diseases (Gunter 1934Citation, Gvritishvili 1982Citation, Saccardo 1882–1931Citation). Many of these species have no known teleomorph. Where teleomorphs are known they are species of Leucostoma, Valsa, Valsella, and Valseutypella, genera in the Diaporthales. Descriptions of Cytospora species are generally based on host, and on morphological features that might be plastic. The size, shape, and arrangement of labrinthiform locules and of stromatic tissues of the pycnidium are the basic characteristics used in differentiating Cytospora species in nature, other than conidium size. Stromatic tissues do not form in agar medium or on sterilized or excised plant substrates. Additionally, the physical and physiological characteristics of the bark and cambium of the host affect the morphology of pycnidial locules and therefore a species might appear dissimilar on different hosts. Usually the more complex morphology of the teleomorph is required for precise identification of the Cytospora anamorph. On many economically important hosts, teleomorphs are rarely formed when cankers are abundant. The identification of the teleomorph is dependent on characters that might also be plastic such as number, size, and arrangement of perithecia and thickness and color of endo- and ecto-stromatic tissues. These features are not formed in culture.

Cytospora cankers cause economic losses worldwide in the cultivation of stone fruit and pome fruit by seriously limiting the productivity and longevity of the trees (Biggs 1989Citation). The cankers are perennial or annual depending on the host. The greatest economic damage occurs in orchards of Prunus persica (L.) Batsch (peach), P. avium (L.) L. (sweet cherry), and P. domestica L. (plum) with perennial canker.

Since cultural practices and chemical treatments do not adequately control the disease, the best control would be the introduction of disease resistant cultivars with acceptable horticultural characteristics. Commercial peach cultivars have failed to show resistance, but a recent study estimates heritability for disease resistance (measured as canker necrotic length) to be relatively high in a diverse peach population (Chang et al 1991Citation).

One of the constraints in the development of resistant cultivars is the lack of knowledge regarding the identification of the pathogens and the heterogeneity of the pathogens. The causal organisms of this disease have been described as two related morphological taxa, Leucostoma persoonii Höhnel and L. cinctum (Fr. : Fr.) Höhnel with Cytospora anamorphs, C. leucostoma Sacc. and C. cinctum Sacc., respectively (von Höhnel 1917Citation). Both teleomorphs occur but rarely on peach (Kern 1955Citation, Wensley 1964Citation). Previous literature refers to L. cincta, but the correct spelling of the species epithet of L. cincta is L. cinctum (D. Farr pers comm).

In previous studies, we found that among 56 isolates of L. persoonii and L. cinctum from cankers on stone fruit and pome fruit trees, there was a minimum of five genetically different groups, called phenetic groups (Surve-Iyer et al 1995Citation). The phenetic groups (PGs) were characterized by isozyme polymorphisms among eight well-resolved enzyme stains, out of 27 tested. Additionally, several of the PGs had unique host, geographic and cultural characteristics. The isolates believed to be L. persoonii had a Jaccard coefficient of similarity equal to zero with the isolates believed to be L. cinctum, and all the isolates in the former species grew well at 33 C whereas, those of L. cinctum did not. Three groups of L. persoonii (PG 1, PG 2, PG 3) and three groups of L. cinctum (PG 4, PG 5, PG 6) were resolved with the 31 alleles at the eight putative loci (Fig. 1, reproduced from Surve-Iyer et al 1995Citation). PG 1, PG 2, and PG 3 shared a Jaccard similarity of only 0.35. Only PG 1 had the cultural characteristic of lobate colony margins, with the colony rarely growing to reach the edge of a 90-mm Petri dish. PG 1 isolates were widespread in occurrence while PG 2 isolates were discovered in Michigan forests, and PG 3 were found in California. Within each of these three PGs, isolates had identical zymograms (no detectable genetic variation). Leucostoma cinctum PG 6 was encountered in Michigan and Wisconsin on Malus domestica Borkh. rather than on Prunus spp. PG 6 was less virulent on peach than other L. cinctum isolates (Proffer and Jones 1989Citation, Surve-Iyer et al 1995Citation). PG 6 also had unique cultural characteristics of releasing a reddish brown pigment and having reddish brown hues and colony colors varying from primrose to hazel, honey or buff (Proffer and Jones 1989Citation, Surve-Iyer et al 1995Citation). PG 6 showed little detectable genetic variation and had a similarity of less than 0.2 with the other L. cinctum isolates in PG5 and PG 4. The latter two groups shared a similarity of 0.4 and might be interbreeding populations with detectable genetic variation. Therefore, we referred to PG 4 and PG 5 as a single group with the designation PG4/5 in this manuscript. We believed that PG4/5 and the other four PGs, likely represented genetically isolated cryptic species. Further virulence differences were associated with the various phenotypic groups (Adams et al 1989Citation, Proffer and Jones 1989Citation, Surve-Iyer et al 1995Citation). Genetic heterogeneity within the phenetic group populations is being studied further (Wang et al 1998Citation, Adams et al 1990Citation).



View larger version (23K):
[in this window]
[in a new window]
 
 FIG. 1. Reproduced phenogram from our previous isozyme studies (Surve-Iyer et al 1995Citation) from which it was inferred that six phenetic groups existed among isolates from Cytospora cankers on fruit trees. Phenetic groups were resolved using 31 alleles at eight putative loci. The phenogram was based on UPGMA distance analysis using the Jaccard Coefficient. The numbers at the ends of branches corresponded to isolate numbers in Table I

 
Within the L. persoonii phenetic groups, PG 1, PG 2 and PG 3, isozyme polymorphisms were not encountered. Indeed, the widespread overrepresentation of some isozyme phenotypes suggested clonal reproduction (Tibayrenc 1997Citation, Tibayrenc et al 1990Citation, 1991Citation). However, genetic diversity within phenetic groups of L. persoonii was revealed by the occurrence of numerous vegetative compatibility groupings and maternal lines in a restricted locale (Wang et al 1998Citation). Therefore, isozyme analysis had not revealed the level of genetic variation that would be expected in a sexually reproducing L. persoonii of world-wide distribution and wide host range.

DNA sequence can provide a large number of characters to assess relationships among isolates and species. The large number of characters also permits the statistical testing of genetic relationships among these organisms (Adams and Taylor 1993Citation, Adams 1995Citation). Our objectives were to re-examine the phenetic groups of L. persoonii and L. cinctum using representative isolates from stone and pome fruit trees, and determine the relationships of the species and groups to other species of Cytospora based on DNA sequence relationships of the internal transcribed spacers and the 5.8S gene (ITS1-5.8S-ITS2) of the nuclear ribosomal DNA repeat unit (rDNA). The purpose was to improve the identification of Cytospora species and to establish tentative working species concepts. We examined many additional isolates using restriction fragment length polymorphism (RFLP) analysis of the ITS1-5.8S-ITS2, the five prime end (5'-) of the nuclear large subunit (LSU), and the nuclear small subunit (SSU) of the rDNA operon in a preliminary survey of genetic variation within the PGs. The purpose was to increase our knowledge of pathogen variability in order to select and use a comprehensive array of isolates in screening fruit trees for potential disease-resistant germplasm.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 
Material examined – Geographic and host origins, and isozyme phenetic grouping of the isolates used in this study are given in Table I . Herbarium specimens of anamorphs or teleomorphs are deposited at the Beal-Darlington herbarium at Michigan State University (MSC) as vouchers for 52 of the cultures (Table I). GenBank accession numbers were listed in Table I for the isolates sequenced. Measurements of the morphological characters of herbarium specimens were made following staining with lactophenol cotton blue and permanent mounting in polyvinyl alcohol lactoglycerol. The mountant contained 8.33 g polyvinyl alcohol (average MW 50 000, Sigma Chemical Company, St. Louis, MO), 50 mL lactic acid, 5 mL glycerol, and 50 mL water (Koske and Tessier 1983Citation). Mountant in the prepared slides was heated for 1 h at 60 C to solidify.


View this table:
[in this window]
[in a new window]
 
TABLE I. Specimens examined

 

View this table:
[in this window]
[in a new window]
 
TABLE I. Continued

 

View this table:
[in this window]
[in a new window]
 
TABLE I. Continued

 
Extant cultures representing seven of Défago's (1935)Citation nine formae speciales of L. persoonii were present in the Centraalbureau voor Schimmelcultures, Baarn, the Netherlands (CBS). Défago's (1935)Citation concept of forma specialis was not equivalent to the current concept. His concept was based on quantitative, not qualitative, differences in the relative level of aggressiveness among pathogenic isolates on an inoculated host range of Prunus species and subspecies. Our studies included the isolates from Europe L. persoonii f. sp. armeniacae Défago (CBS 260.34), f. sp. avium Défago (CBS 261.34), f. sp. Cerasi Défago (CBS 262.34), f. sp. Claudianae Défago (as f. sp. institutiae, CBS 263.34), f. sp. Mahaleb Défago (CBS 264.34), f. sp. oeconomicae Défago (CBS 265.34), and f. sp. persicae Défago (CBS 266.34). Japanese isolates representing f. sp. Togashi were apparently lost.

PCR amplification – Total genomic DNA was extracted and purified from lyophilized hyphae of the isolates using the standard fungal protocol (Lee and Taylor 1990Citation). Between, 1–50 ng of the total genomic DNA was used per 100 µL reaction mixture for polymerase chain reaction amplification (PCR) (White et al 1990Citation). Standard prepackaged buffers and polymerases were used for PCR amplification following the methods of White et al (1990)Citation. Primers used for the ITS region included ITS1, ITS2, ITS3, ITS4 (White et al 1990Citation), and for the LSU CTB6 (5' GCATATCAATAAGCGGAGG 3'), and TW14 (5' GCTATCCTGAGGGAAACTTC 3') (designed by T. Bruns and T. White). For amplifications of the SSU rDNA, the following primers were used: NS5, NS8 (White et al 1990Citation); NS21UCB, NS22UCB, INS23 the complement of NS23UCB (Gargas and Taylor 1992Citation); ANS5 (5' GTAAAGTTTTTGGGTTCTGGG 3'), ANS7 (5' AGGGACTATCGGCTCAAG 3'), and ANS8 (5'ACTTTGAGACAGCACGAC 3').

PCR reactions were performed in a DNA Thermal Cycler (Perkin-Elmer Corporation, Norwalk, Connecticut) programmed as follows: a 2-min hot start of 94 C followed by 35 cycles of 1 min 94 C, 1 min 50 C and extension for 45 s at 72 C. The 45 s extension period was lengthened each cycle by 4 s. The amplification was ended with a final 7 min extension at 72 C.

Endonuclease digests – Ten µL of a PCR product of the ITS-LSU rDNA region (amplified by the primer pair ITS1/TW14) for each isolate was digested in 20 µL reactions with a restriction endonuclease according to the manufacturer's instructions. Forty restriction endonucleases (primarily those that recognize 4 base pair cutting sites) were used to screen for sites in the ITS1-TW14 amplicon (PCR-RFLP analysis) of six isolates. Each isolate was representative of one of the six known isozyme phenetic groups. From the 40 restriction endonucleases, 13 were used to screen all isolates (Table II). Following the screening, location of restriction sites and polymorphisms were empirically determined by separately digesting subdivisions of the ITS-LSU rDNA amplicon, including the amplicons from the primer pairs ITS1/ITS4, and CTB6/TW14.


View this table:
[in this window]
[in a new window]
 
TABLE II. Distinct fragment patterns from the digest of the ITS-LSU rDNA molecule

 
Gel electrophoresis – PCR amplification and endonuclease digest products were fractionated by electrophoresis on 3–4% (wt/vol) agarose gels (2–2.25% NuSieve, 1–1.75% Seakem GTC agarose; FMC Bioproducts, Rockland, Maine) buffered in 1 x TAE (0.04 M Tris-acetate, 0.001 M EDTA, pH 8.0). Ethidium bromide (0.2 ppm) was included in the gels followed by destaining 20 min in distilled water to permit visualization of the DNA fragments with ultraviolet light. Sizes of DNA fragments were measured by comparison to a 1 kb and a 123 bp DNA Ladder (Gibco BRL Life Technologies, Inc., Gaithersburg, Maryland). Restriction patterns on gels were photographed with UV transillumination.

Two hundred µL of each product (not exposed to ultraviolet light) were purified by washing four times by centrifugation of 4000 g with sterile distilled water through a 30 000 NMWL Millipore Ultrafree-MC filter (Millipore Corporation, Bedford, Massachusetts). Washed products were used in sequencing reactions or in restriction digests.

Cleaned PCR products were used for a second PCR amplification of 30 cycles (as above) to produce single-stranded DNA (Gyllensten and Erlich 1988Citation). Single-stranded template was produced from asymmetric amplification of double-stranded PCR template by using one primer in excess at 0.5 µmole and the limiting primer at 0.025 µmole. Sequencing primers, either internal or external (see above), were used to sequence both the coding and non-coding strands by the dideoxynucleotide chain-termination method (Sanger et al 1977Citation) incorporating 35S-dATP as described by Brow (1990)Citation using the TAQuence kit (US Biochemical Corporation, Cleveland, Ohio) and standard methods (Sambrook et al 1989Citation).

Sequences were read then sequence fragments merged, visually edited and aligned using ESEE version 1.09e (Cabot and Beckenbach 1989Citation). A composite consensus sequence for each isolate was proofread. Sequences for each of the strains were aligned with CLUSTAL W 1.75 (Thompson et al 1994Citation), visually proofread and again aligned with CLUSTAL and proofread.

Insertion/intron analysis – All isolates in Table I were screened for length variations by comparing the sizes of PCR products from amplifications of the SSU rDNA using the primer pairs NS21UCB/NS22UCB and ANS5/ANS8 fractionated by electrophoresis on agarose gels. Subsequently, approximately 41 other isolates were similarly screened in a related study (Wang et al 1998Citation). Isolates containing large insertion sequences within the SSU rDNA region were recorded in Table I. The locations of insertion sites was determined based on the intron labeling system of Gargas et al (1995)Citation. Site locations corresponded to the homologous nucleotide position for the 5' flanking nucleotide in the Escherichia coli SSU rDNA (Gutell 1993Citation).The relevant region of the SSU rDNA of a representative isolate containing the insertions, LP47 L. cinctum PG 5, and representative isolates without the insertions, LP8 L. persoonii PG 1 and A45 L. cinctum PG 6, were sequenced and compared. Insertion sequences were compared to determine if they possessed the sequence elements conserved among Group 1 introns (Cech 1988Citation). Insertion sequences were sent to Robin R. Gutell for further characterization to intron subgroup (Michel and Westhof 1990Citation), and production of illustrations representing secondary structure (Cech et al 1994Citation). The entire sequence of each insertion without flanking regions was used as a query to search for similar sequences in GenBank. The searches were performed using the Basic Logical Alignment Search Tool algorithm, BLAST (Altschul et al 1997Citation).

Data analysis – The ITS1-5.8S-ITS2 rDNA sequences were analyzed as uniformly weighed unordered characters, and as interleaved blocks of aligned sequence. Insertions/deletions (indels) and gaps were introduced for alignment purposes. In one analysis, indels and gaps were coded by the simple coding method of Simmons and Ochoterena (2000)Citation. All gaps that had different 5' and/or 3' termini were coded as separate present or absent characters. The longer gaps in a set of sequences with different but completely overlapping gaps were coded as inapplicable for the shorter gap character being coded. In a second analysis, indels and gaps were treated as missing data rather than being coded. The ITS1-5.8S-ITS2 rDNA sequences of L. persoonii and L. cinctum isolates were compared in phylogenetic analysis with 44 different Cytospora strains that we have sequenced. Sequences have been deposited in GenBank (Table I) and the two alignments of the sequences have been submitted to TreeBASE as SN472-2915 and -2916.

Phylogeny of the Cytospora isolates was determined with PAUP version 4.0 beta (Swofford 2000Citation) using maximum parsimony (Swofford and Maddison 1987Citation) and the tree bisection-reconnection branch swapping algorithm (TBR) saving no more than 200 shortest trees. A tree from the most parsimonious trees (MPT) was displayed using TreeView (Page 1996Citation): Fig. 2a with coded indels, Fig. 2b without. The consensus tree was determined using 2000 heuristic searches (Hedges 1992Citation) performed by bootstrapping (Felsenstein 1985Citation). Confidence intervals for branches on the consensus tree were placed onto the MPT (Fig. 2a, b). Diaporthe vaccinii Shear was chosen to infer an outgroup because the teleomorph of Diaporthe Nitschke was similar in morphology to the teleomorphs of Cytospora; Leucostoma (Nitschke) Höhnel, Valsa Fr. and Valsella Fuckel.



View larger version (41K):
[in this window]
[in a new window]
 
 FIG. 2. Phylogram of species of Cytospora chosen from one of the most parsimonious trees. The species relationships were inferred from parsimony analysis of DNA sequence of the internal transcribed spacers and the 5.8S regions of the nuclear ribosomal DNA operon. Branch lengths corresponded to inferred genetic distances with the units of the bar equaling the number of expected nucleotide substitutions per site. The scale bar was of a branch length equal to 10 nucleotide substitutions. Numbers at nodes were bootstrap (2000 replications) indices of support greater than 50%. Vertical distances were arbitrary. A. Indels and gaps introduced for alignment were coded such that those that had different 5' and 3' termini were treated as separate presence or absence characters. The longer gaps in a set of sequences with different but completely overlapping gaps were coded as inapplicable for the shorter gap character being coded. B. Indels and gaps were treated as missing data

 


View larger version (38K):
[in this window]
[in a new window]
 
FIG. 2. Continued.

 
The ITS-LSU rDNA restriction digest results of an endonuclease digest were recorded as a distinct pattern consisting of profiles of fragment(s). Coding the data in this manner reduced the impact of the presence of length mutations that would both add or subtract restriction sites and change fragment lengths. Such errors due to length mutations would be multiplied when many restriction endonucleases were used (Bruns et al 1991Citation). Each isolate was characterized by its combination of electrophoretic patterns (RFLP digest patterns) over the number of endonucleases used. RFLP digest patterns for each endonuclease and each isolate were summarized in Table II. Distinctive profiles of patterns, corresponding to unique genotypes, were designated Electrophoretic Types (ETs). The ET for each isolate was the series of letters (row of letters) following the isolate code in Table II.

Fragment data from the RFLP analysis was used to determine distances between PG 1 isolates of L. persoonii, using the RESTSITE program (Miller 1990Citation). RESTSITE used a maximum likelihood method (Nei and Tajima 1983Citation) of estimating the expected number of nucleotide substitutions per site (d) from the expected number of shared DNA fragments (F), for each endonuclease (Nei and Miller 1990Citation). A matrix of the d values was submitted to TreeBASE as SN472-2917. The NEIGHBOR subprogram of PHYLIP version 3.5 (Felsenstein 1997Citation) was used in UPGMA analysis of the distance matrix of d values. An unrooted tree displaying diversity within the ITS spacer and LSU-rDNA gene among isolates of the species was presented in Fig. 3. Branches of the tree were labeled with the estimated number of nucleotide substitutions corresponding to the lengths of the branches.



View larger version (20K):
[in this window]
[in a new window]
 
 FIG. 3. Phenogram summarizing the estimated genetic variation determined by RFLP analysis of the PCR amplicon of the internal transcribed spacers, the 5.8S, and the five prime end of the large subunit of the nuclear ribosomal DNA operon (ITS-LSU rDNA) among isolates of L. persoonii sensu stricto (formerly, L. persoonii isozyme phenetic group 1). Thirteen restriction endonucleases were used to identify polymorphisms and produce fragment patterns listed in Table II. Fragment patterns were used to produce a matrix of d values with the RESTSITE program. The UPGMA algorithm was used in analysis of the distance matrix and construction of the tree. Branch lengths corresponded to the estimated number of nucleotide substitution changes

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 
ITS1-5.8S-ITS2 phylogenetic analysis – Length of DNA sequence for each isolate, inclusive of introduced gaps to permit alignment of the entire set, was 571 nucleotides. Coding of gaps increased the length to 683 characters. Coded sequence had 176 parsimony-informative characters, non-coded had 115.

Results of phylogenetic analyses of sequence data of the L. persoonii and L. cinctum isolates and 44 other taxa was represented as two phylograms, Fig. 2a and b. Bootstrap confidence levels on branches having values of 50% or greater were shown. Parsimony analysis of the coded sequence gave 200 MPTs each of 671 steps and consistency index (CI) of 0.501, retention index (RI) of 0.771 and a re-scaled consistency index (RC) of 0.386. The displayed tree in Fig. 2a had the best -Ln likelihood (4694.473) ranking using the Kishino-Hasagawa test. Parsimony analysis of the non-coded sequence gave 200 MPTs each of 448 steps and consistency index (CI) of 0.529, retention index (RI) of 0.800 and a re-scaled consistency index (RC) of 0.423. The displayed tree in Fig. 2b had the best -Ln likelihood (3491.281) ranking using the Kishino-Hasagawa test. We labeled several clusters of taxa on Fig. 2a and b as groupings inferred by the gene tree. The groupings were tentative estimates of phylogenetic species inferred by one locus. For the present discussion, we interpreted the gene tree as a tentative species tree with groupings estimating tentative working species concepts. A comprehensive molecular phylogeny of species in Leucostoma, Valsa, Valsella, Valseutypella Höhnel, and the Cytospora anamorphs, will be presented in a later publication.

The phylogram divided L. persoonii isolates into two well-resolved groups, L. persoonii sensu stricto group, L. parapersoonii sp. nov., and divided L. cinctum isolates into a third well-resolved group. Leucostoma cinctum included the isolate representative of V. japonica Miyabe & Hemmi. This was surprising because Kobayashi (1970)Citation stated that V. japonica was a likely synonym of V. ambiens. An isolate representative of L. curreyi (Nitschke) Défago, a pathogen of conifers, was closely related to the isolates on deciduous hosts.

The L. persoonii isolates of PG 1 formed a clade we referred to as the L. persoonii sensu stricto group. This group encompassed significant variation and included isolates intermediate between L. persoonii and L. massariana (De Not.) Höhnel such as Sorbus, a group of Michigan isolates from several trees of Sorbus aucuparia L. Surprisingly, one isolate representative of Valsa mali Miyabe & Yamada apud Ideta was part of the L. persoonii sensu stricto group.

Isolates we formerly called L. persoonii PG 2 and PG 3 were identical in ITS-rDNA sequence and were grouped separately from the other L. persoonii by the phylogenetic analysis. We believed that the phylogram provided additional information to infer that this group represented a new species. This inferred new species was more distant from L. persoonii sensu stricto than the group of isolates that included L. masariana, Valsella melastoma (Fr.) Fuckel, L. translucens (De Not.) Höhnel, and L. niveum (Hoffm. : Fr.) Höhnel. Previous literature referred to L. nivea, but the correct spelling of the species epithet of L. nivea is L. niveum (D. Farr pers comm).

Based on a combination of distinct characteristics a new species was described below.

PCR-RFLP analysis – Polymorphisms in the ITS-LSU rDNA amplicons were evident among the collection of isolates following digestions with 13 of 40 restriction endonucleases tested. The 13 endonucleases were AluI, BstEII, BstNI, BstUI, EcoNI, HinfI, HpaII, MboI (= Sau3AI), MseI, RmaI (= BfaI), RsaI, ScaI, and TaqI. For all isolates tested, the ITS1/ITS4 amplicons (ITS rDNA) did not have restriction site with BstEII. The CTB6/TW14 amplicons (LSU rDNA) showed polymorphisms with the four endonucleases, BstEII, BstUI, HpaII and HinfI. The LSU rDNA region had no sites for BstNI, RmaI, and ScaI. Fragments as small as 20 bp were resolved on the agarose gels.

Results from endonuclease digests showed considerable variation in the ITS-LSU rDNA molecules among isolates of L. persoonii sensu stricto, Table II. However, variation was slight in L. cinctum PG4/5, L. cinctum PG 6, and L. parapersoonii (formerly PG 2 and PG 3). The phenogram in Fig. 3 displayed the amount of estimated variation in the ITS-LSU rDNA of L. persoonii sensu stricto (PG 1) that was measurable with our RFLP analysis, as well as the amount of variation between and among individual isolates. The Quince1 isolate, and isolates representative of L. persoonii f. sp. cerasi and L. persoonii f. sp. persicae were most unusual (Fig. 3).

Intron/insertion analysis – The 50 L. persoonii sensu lato isolates representative of the isozyme phenetic groups PG 1, PG 2, PG 3 and the formae speciales of Défago did not contain any unique length mutations in the SSU rDNA (Table I). This was also true of the 11 L. cinctum isolates from M. domestica which were representative of PG 6. In contrast, all the 22 isolates of L. cinctum from Prunus representative of PG 4 and PG 5 contained two large insertions (length mutations), one at site 943 amplified by the primer pair NS21UCB and INS23, and another at site 1199 amplified by the primer pair ANS7 and ANS8. In our related study (Wang et al 1998Citation) all 41 isolates of L. cinctum from peach in Michigan also showed the insertions. No isolate of L. cinctum from a Prunus host was found to lack these insertions. Furthermore, the insertions were transmitted to ascospore progeny, isolates Flb, Flf, Flg, FlH, Flr, Fls, and Flu (Table I), following sexual reproduction.

DNA sequence of the SSU rDNA gene of L. persoonii isolate Lp8 (Berbee and Taylor 1992aCitation, bCitation, GenBank M83259) and L. cinctum isolate Lp47 contained all the conserved sequence domains typical of the SSU subunit. The two extra insertions that were present in the SSU sequence of L. cinctum isolate Lp47 had discrete boundaries. The first insertion was 415 nucleotides long. Analysis of the sequence demonstrated that it possessed the characteristic features conserved among Group 1 introns (Cech 1988Citation). The sequences of the conserved elements P, Q, R, S of the core structure of the first insertion, intron 1 of the L. cinctum SSU rDNA, were P = 5' GUACUGGAAA 3', Q = 5' AAUCCGCAGC 3', R = 5' UCAGAGACUAAA 3', and S = 5' AAGAUAUAGUCC 3'. Leucostoma cinctum intron 1 matched the characteristics of a Group 1 intron of the subgroup IC1 (Michel and Westhof 1990Citation). A diagrammatic representation of its secondary structure was shown in Fig. 4 and it was placed in the intron database of Robin Gutell (Damberger and Gutell 1994Citation). The sequence of L. cinctum intron 1 was deposited in GenBank as AF191167.



View larger version (27K):
[in this window]
[in a new window]
 
 FIG. 4. The diagram represented the predicted secondary structure of Group 1 intron 1 of subgroup IC1 in the SSU rDNA in isolates of L. cinctum belonging to the isozyme phenetic groups 4 and 5 from Prunus spp. Intron 1 occurred at insertion site 943. Arrowheads indicated the 5' and 3' splice sites. Intron sequence was in upper case letters while exon sequences were in lower case. The conserved helical regions were labeled P1-10. The diagrams were of a standardized format that was described in Cech et al (1994)Citation

 
Significant sequence similarity to intron 1 was found in the GenBank database within the SSU rDNA introns of Graphium putredinis (Corda) S. J. Hughes and Pseudallescheria boydii (Shear) McGinnis, Padhye & Ajello showing homology scores of 144 bits and identity 89%, and 140 bits (88%), respectively (Issakaines et al 1997Citation). If the entire length of intron 1 was considered, the SSU rDNA intron of Cordyceps militaris (L.) Link (embAJ007571.1) had more similarity in secondary structure as it showed some homology throughout the entire length, particularly elements Q, R, S, and two large loops near the five prime end.

The second insertion was 309 nucleotides long and was located at the intron insertion site 1199 (Gargas et al 1995Citation). Analysis of the sequence demonstrated that it possessed unusual characteristics among Group 1 introns. The conserved elements R and S were identifiable: R = 5' GCAACGCGCGCA 3' and S = 5' AAGGUAC-GUCC 3'. The second insertion was identified as a Group 1 intron based on the presence of characteristic base-paired regions denoted as P3 through P8 that form the catalytic core (Michel et al 1982Citation). Intron 2 of the L. cinctum SSU rDNA was of an unknown and new subgroup (Robin Gutell pers comm). A diagrammatic representation of its secondary structure was shown in Fig. 5, and it was placed in the intron database of R. Gutell. The sequence of L. cinctum intron 2 was deposited in GenBank as AF191168.



View larger version (23K):
[in this window]
[in a new window]
 
 FIG. 5. The diagram represented the predicted secondary structure of Group 1 intron 2 of unknown subgroup in the SSU rDNA in isolates of L. cinctum belonging to the isozyme phenetic groups 4 and 5 from Prunus spp.from Prunus spp. Intron 2 occurred at insertion site 1199. Arrowheads indicated the 5' and 3' splice sites. Intron sequence was in upper case letters while exon sequences were in lower case

 
The highest sequence similarity to intron 2 found in GenBank was in the S element of the SSU rDNA intron of Dendryphiopsis atra (Corda) S. J. Hughes (gbAF053731) that showed homology scores of only 50 bits, identity 96%. However, the SSU rDNA intron of Cryphonectria parasitica (Murrill) Barr (gbL42441) shared homology throughout the entire length of intron 2, particularly elements R and S. The loop structure of the P1 base-paired region in intron 2 had high homology with the P1 loop of C. parasitica. This was unexpected because a primary source of variation in Group 1 introns was the size of loop structures of the P1 and P5 base-paired regions (Collins 1988Citation).


    TAXONOMY
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 

Leucostoma parapersoonii Adams, Surve-Iyer, et Iezzoni sp. nov. Figs. 6–8



View larger version (191K):
[in this window]
[in a new window]
 
 FIGS. 6–8. Leucostoma parapersoonii. 6. Discs of ascomata with multiple black ostioles, erumpent through lenticels in bark. Bar = 1.5 mm. 7. Horizontal cross section through ascomata, showing entostroma surrounding beaks of perithecia. Bar = 2.0 mm. 8. Perithecia in circinate arrangement surrounded by entostroma of ascomata. Bar = 3 mm. FIGS. 9–11. Leucocytospora paraleucostoma. 9. Discs of conidiomata with one to two ostioles, erumpent through lenticels in bark. Bar = 1 mm. 10. Horizontal cross section through conidioma showing multi-chambered locule. Bar = 2 mm. 11. Conceptacle (left) exposed after lifting out the entire locule of the conidioma (right, out of focus). Conceptacle subtends and delimits the conidioma. Bar = 2 mm

 
Anamorph Leucocytospora paraleucostoma Adams, Surve-Iyer, et Iezzoni sp. nov. Figs. 9–11

Ascostromata in cortice ramorum mortuorum immersa, disco erumpenti in lenticella, circularia, usque ad 3 mm in diametro. Discus lenticularis ad longe lenticularis, (0.8–) 1–2 x (0.3–) 0.5–0.7 mm, albus ad calendulinus, coactus, convexus ad planiusculus, plerumque prominens. Ostiola nigra, 155–265 µm in diametro, superficiem disci fere aequantia, in seriebus 1 vel 2 plus minusve disposita, (2–) 5–14 in quoque disco. Perithecia (5–) 7–14 circinatim disposita sub disco, globosa, (400–) 500–600 (–660) µm, brunnea, parietibus texturae epidermoideae, rostris longis in disco a latere insertis, ab entostromate coacto laxo albo ad calendulino circumcincta et a conceptaculo nigro patelliformi usque ad 40 µm crasso subtenta. Asci liberi, longe obovoidei ad clavati, (25–) 36–53 (–60) x 5–7 (–8) µm, punctis duobus refractivis chitinoideis in apparatu apicali nonamyloideo instructi. Ascosporae biseriatae, longe allantoideae, parietibus tenuibus, hyalinae, (9–) 11–13 (–15) x 2–1.6 µm, 8 in quoque asco. Anamorphi a teleomorphis distantes, plerumque e ramulis gracilibus aliis exorientes. Stroma conidiomatale usque ad 2 x 1.5 mm in diametro, a conceptaculo griseo ad nigro patelliformi plerumque limitatum. Disci conidiomatales albi ad pallide grisei, coacti, convexi ad planiusculi, e lenticellis corticalibus erumpentes, ostiolis usque ad 3 in foramine lenticellae insertis et discum compositum producentibus, 500–1200 x 200–400 µm. Ostiola conidiomatalia cretaceo-grisea, furfuracea, e materia amorpha composita. Conidioma ostiolo singulo inserto in disco reducto bene evoluto. Loculus ad genus complexum multicubiculatum pertinens, divisus per invaginationes in cubiculos regulares radiatim dispositos parietibus communibus, ut in sectione Cytospora generis Cytosporae Ehrenb. : Fr. Cellulae condiogenae eramosae vel interdum ad basin ramosae, enteroblasticae, phialidicae, hyalinae, subcylindricae et attenuatae ad apicem collulo minuto et parum periclinaliter incrassatum, 9–17 x 0.7–1 µm. Conidia hyalina, eguttulata, allantoidea, (4.5–) 5–7 x 1–1.5 µm. Conidiophora et conidia in matrice continua gelatinosa inclusa. Loculus siccus totus e conceptaculo tolli potest.

Ascostromata in cortice ramorum putridorum immersa, disco in lenticellis erumpenti. Ascostromata circularia usque 3 mm diametro. Discus lenticularis vel elongato-lenticularis, (0.8–) 1–2 x (0.3–) 0.5–0.7 mm, albus vel saturate calendulinus, coactus, pulvinatus vel subplanus, typice prominens. Ostiola 5–14 per discum, nigra, 155–265 µm diametro, paene superficiei disci plana, sublineariter in unica vel duabus seriebus disposita. Perithecia (5–) 7–14, sub disco circinatim disposita, globoidea, (400–) 500–600 (–660) µm diametro, castanea, parietibus e textura epidermoidea compositis praedita, rostris longis in disco lateraliter intrusis instructa, entostromate laxo albo vel saturate calendulino coacto circumcincta atque conceptaculo nigro scutelliformi usque 40 µm crasso subtenta. Asci liberi, longi–obovoidei vel clavati (25–) 36–53 (–60) x 5–7 (–8) µm, punctis duobus refractivis chitinoideis in apparatu apicali nonamyloideo ornati. Ascosporae 8 per ascum, biseriatae elongatae allantoideae tenuitunicatae hyalinae, (9–) 11–13 (–15) x 2–1.6 µm. Anamorpha et teleomorpha plerumque in virgis tenuibus distinctis segregata. Stroma conidiomaticum usque 2 x 1.5 mm diametro plerumque conceptaculo griseo vel nigro limitatum. Discus conidiomaticus 1200–500 x 200–400 µm, multiplex ex usque 3 ostiolis compositus, albus vel pallide griseus, coacti, pulvinatus vel subplanus, lenticularis, in lenticellis corticalibus erumpens. Ostiola conidiomatica cretaceo–cinerea, furfuracea, e materia amorpha composita. Conidioma ostiolo unico in disco reducto eumorpho inserto instructa. Loculus formae multiplicis multiloculatae sectioni Cytosporae generis Cytospora Ehrenb. : Fr. similis, plicatus, in locellos regulares radiatim dispositos atque parietibus communibus praeditos multipartitus. Cellulae conidiogenae simplices vel ad basem interdum ramiferae, enteroblasticae, phialidicae, hyalinae, sybcylindricae, in apicem collarculo minuto atque area subcrassa periclina instructum contractae, 9–17 x 0.7–1 µm. Conidia hyalina, eguttulata, allantoidea, (4.5–) 5–7 x 1–1.5 µm. Conidiophora conidiaque in in matrice gelatinosa continua inclusa. In statu sicco, loculus totus multipartitus e conceptaculo separabilis.

Ascostromata immersed in bark of dead branches with disc becoming erumpent into a lenticel. Ascostroma circular, up to 3 mm in diameter. Disc lenticular to elongate-lenticular, (0.8–) 1–1.5 (–2) x (0.3–) 0.5–0.7 mm, white to deep orange-yellow, Munsell notation 8.6YR6.0/12.1 (Kelly and Judd 1955Citation), felty, convex to nearly flat, usually prominent. Ostioles black, 155–265 µm in diameter, nearly level with disc surface, arranged somewhat linearly in one to two rows, (2–) 5–14 ostioles per disc. Below the disc, (5–) 7–14 perithecia are circinately arranged. Perithecia globoid (400–) 500–600 (–660) µm in diameter, medium brown with walls of textura epidermoidea and long beaks laterally inserted into the disc. Perithecia surrounded with a loose, white to deep orange-yellow, felty entostroma and subtended by a black dish-shaped conceptacle up to 40 µm thick. Asci free, long-obovoid to clavate, (25–) 36–53 (–60) x 5–7 (–8) µm, with two refractive chitinoid dots (ring) in the nonamyloid apical apparatus. Ascospores biseriate, elongate allantoid, thin walled and hyaline, (9–) 11–13 (–15) x 2–1.6 µm, eight per ascus. Anamorph separate from teleomorph and usually on different slender branches. Conidiomatal stroma up to 2 x 1.5 mm in diameter, usually delimited by a gray to black dish-shaped conceptacle. Conidiomatal discs white to light gray, felty, convex to nearly flat, lenticular, erumpent through lenticels in bark, up to 3 ostioles inserted into lenticel opening forming compound disc, 1200–500 x 200–400 µm. Conidiomata ostioles chalky gray, furfuraceous, formed of amorphous material. Conidioma with a single ostiole inserted in a reduced, well-developed disc. Locule of the complex multi-chambered type subdivided by invaginations into regular radially-arranged chambers sharing common walls, similar to section Cytospora of genus Cytospora Ehrenb. : Fr. Conidiogenous cells unbranched or occasionally branched at the base, enteroblastic phialidic, hyaline, subcylindrical and tapering to an apex with minute collarette and slight periclinal thickening present, 9–17 x 0.7–1 µm. Conidia hyaline, eguttulate, allantoid, (4.5–) 5–7 x 1–1.5 µm. Conidiophores and conidia embedded in a continuous gelatinous matrix. When dry, the entire multi-chambered locule can be lifted out of the conceptacle.

Culture characteristics. On standard media such as potato dextrose agar, colony margins were entire, not distinctly lobate, and growth uniformly approached and contacted the edges of 90 mm Petri dishes. Colonies became olivaceous to deep mouse gray and pycnidia were large in diameter, 1.0–3.0 mm. Growth rate was good at 33 C, only slightly less than at the optimum, 27 C. The two known geographically distinct populations (Michigan and California) differed by polymorphisms in several isozyme alleles but were indistinguishable in culture, on the host, and in DNA sequence of the ITS rDNA spacer molecules.

Anamorpha. Leucocytospora paraleucostoma Adams, Surve-Iyer, et Iezzoni sp. nov.

Etymology. In reference to the similarity in morphology to Leucostoma persoonii Höhnel and its anamorph Cytospora leucostoma Sacc.

Hosts. Prunus serotina Ehrh., P. cerasus L., P. domestica L., and P. persica (L.) Batsch var. nucipersica (Suckow) C. K. Schneid.

Distribution. Michigan, California, USA.

Specimens examined. USA, MICHIGAN: Jackson, Roberts Reserve (Michigan State University) on dead branch of P. serotina in forest, 5 Nov 1999, G. Adams. (HOLOTYPE of L. parapersoonii, MSC 375221), (HOLOTYPE of L. paraleucostoma, MSC 375222).

DNA source – Leucostoma parapersoonii isolate LCN (formerly, L. persoonii PG 3 isolate LCN), MSC375214. DNA sequence of the internal transcribed spacers and the 5.8S ribosomal RNA gene of the nuclear ribosomal repeat operon: GGATCATTGCTGGAAGCGCCGCAAGGTGCACCCAGAAACCCTTTGTGAACTT ATACCTATATCGTTGCCTCGGCGCCGGCCGCCTCTCCCTCGTGGAGGGGGCC CCCTCCTGGTCGTAAAAAGCCAGGGGAGGACAGCAGGCCCGCCGGTGGCCTA CTAAACTCTTGTTTTTATTGAGTAAAATCTGAGTAAGCTTCTAAATGAATCA AAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGA AATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA ACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTCGAGCGTCAT TTCAACCCTCAAGCCTAGCTTGGTGTTGGGGCATTACCTGACTGTTTACAGA AGGGTAAGCCCTGAAATTTAGTGGCGAGCTCGCCAGGACTCCGAGCGCAGTA GTTAAACCCTCGCTTTGGATAGTACTGGCGCGGCCCTGCCGTAAAACCCCCA ACTTCTGAAAATTTGAC


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 
The phylogenetic reconstruction of Cytospora species based on the ITS1-5.8S-ITS2 rDNA sequence data (Fig. 2a, b) provided additional information to clarify the relationships among the pathogens on stone and pome fruit trees. Combining data from previous studies of these isolates, that included teleomorph morphology, host preference and virulence, geographic location, cultural characteristics, and multi-locus isozyme analysis (Adams et al 1989Citation, 1990Citation, Proffer and Jones 1989Citation, Surve-Iyer et al 1995Citation, Wang et al 1998Citation), with the one-locus phylogenetic analysis, RFLP analysis, and intron presence/absence herein, provided a foundation on which we could better understand the species L. persoonii and L. cinctum, and their subgroups.

Phylogenetic reconstruction clustered isolates of L. cinctum, with teleomorph characters that were morphologically identical, into one group. Therefore, phylogenetic reconstruction based on the ITS-rDNA did not support the separation by isozyme analysis of the different phenetic groups PG 4, PG 5, and PG 6. The L. cinctum group was composed of, presumably, genetically isolated populations PG 4/PG 5 and PG 6. For example, L. cinctum PG 4/PG 5 and PG 6 occurred in the same locales in Michigan but exhibited differences in cultural morphology, plant host preferences and virulence (Proffer and Jones 1989Citation), isozyme patterns (Surve-Iyer et al 1995Citation), and intron presence/absence. Genetic barriers to breeding probably existed between PG4/PG5 and PG6 because each group frequently formed abundant teleomorphs in the same locales in Michigan, and isolates with intermediate characters were not found. Presumably, the PG4/5 and PG6 became genetically isolated relatively recently because the ITS-rDNA sequence homology remained high. The cluster of L. cinctum isolates was closely related to L. curreyi, a pathogen of conifers. It could be inferred that the latter species was representative of a species from which L. cinctum diverged. Presumably this divergence was initiated by adaptation from pathogenesis on a conifer host to a deciduous host. Alternatively, it could be inferred that L. curreyi was part of the same population as L. cinctum and the influence of the host substrate was responsible for the differences in the teleomorph morphology. These alternative hypotheses would be testable if a system was developed that accomplished both natural infection and formation of teleomorphs on the hosts.

Phylogenetic reconstruction clustered isolates of L. persoonii sensu lato, with teleomorph characters that were morphologically identical, into two well-resolved groups based on sequence homology: the L. persoonii sensu stricto group (formerly PG 1 isolates), and the new species L. parapersoonii (formerly PG 2 and PG 3 isolates). Therefore, phylogenetic reconstruction based on the ITS-rDNA supported, in part, the separation by isozyme analysis of the different phenetic groups PG 1 from PG 2 and PG 3. Cultural characteristics, reported in detail in Surve-Iyer et al (1995)Citation, were most informative in inferring relationships among isolates. Isolates that had lobate colony margins and that usually stopped growth before reaching the diameter of the 90 mm Petri dish of Difco potato dextrose agar (Difco Company, Detroit, Michigan) (PG 1 in Fig. 3 of Surve-Iyer 1995Citation) were clustered by phylogenetic reconstruction into the L. persoonii sensu stricto group, whereas, isolates with entire colony margins that grew to fill the dish (PG 2, PG 3 in Fig. 3 of Surve-Iyer 1995Citation) were separated into L. parapersoonii sp. nov.

Sequence, RFLP analysis and cultural characteristics showed little or no variation within or between PG 2 and PG 3. These characteristics did not support the variation detected in isozyme analysis between PG 2 and PG 3. The isolates of PG 2 all originated in Michigan, whereas PG 3 all originated in California, therefore, it could be inferred that PG 2 and PG 3 were two geographically-separated populations of one potentially interbreeding species. PG 2 and PG 3 isolates were separated in the phylograms of Fig. 2a, b from the L. persoonii sensu stricto group by L. masariana, L. translucens, L. niveum, and Valsella melastoma. Using the results of multi-locus isozyme analysis, geographic proximity, differences in cultural characteristics, and inference from the one-locus phylogenetic reconstruction, we concluded that the evidence was sufficient to place the PG 2 and PG 3 isolates into a previously unrecognized species that we described herein as L. parapersoonii sp. nov. The differentiation of L. persoonii sensu stricto from L. parapersoonii should be of advantage to plant science in current breeding efforts directed to selection for disease resistance in P. persica and P. avium (Chang et al 1989Citation, 1991Citation).

Introduction of PG 3 isolates from California into the P. serotina Ehrh. (black cherry) forests of Michigan, where PG 2 teleomorphs and PG 1 teleomorphs were abundant, would provide conditions to test the species hypothesis. However, this would be prohibited by quarantine regulations.

Leucostoma persoonii sensu stricto showed significantly more variation in sequence and RFLP analysis than was observed in the earlier isozyme studies. The phylogenetic reconstruction also clustered the V. mali isolate from Japan into L. persoonii, thus providing support for the inference that V. mali was a synonym. This was unexpected because V. mali was believed to be a possible synonym of V. ceratosperma according to Kobayashi (1970)Citation. RFLP analysis, isozyme analysis, and phylogenetic reconstruction supported the inference that isolates in Défago's L. persoonii f. sp. avium, f. sp. armeniacae, and f. sp. oeconomicae were similar to isolates in P. avium orchards near the Columbia River in Oregon. Perhaps exchange of scion wood between continents had dispersed fungal lineages. Little difference in ITS-rDNA sequence distinguished L. persooni f. sp. institutiae and f. sp. mahaleb from other members of L. persoonii sensu stricto. However, greater variation was evident in isolates of f. sp. cerasi and f. sp. persicae, and in isolate Quince1, based on RFLP fragment patterns. Divergence among isolates was emphasized by extended branch lengths in the phenogram, Fig. 3. The Quince1 isolate was sequenced, and only minor differences in the ITS rDNA region were ascertained. Sequencing the LSU rDNA amplicon from these three isolates would clarify the basis of the genetic differences, and possibly improve the resolution of their natural relationships among the L. persoonii sensu stricto isolates.

The formae speciales of Défago were defined by their variable virulence on species of Prunus. We demonstrated that differences in virulence were common among isolates within a phenetic group (Surve-Iyer et al 1995Citation). Also, we demonstrated that differences in the susceptibility of individual trees, used in standardized inoculation trials, constituted the major source of variation (statistical error) in virulence trials (Adams et al 1989Citation), despite the fact that scion wood of the trees was clonally propagated. The source of statistical error likely was present in the inoculation trials of Défago (1935)Citation.

RFLP analysis of PCR amplified ribosomal ITS-LSU rDNA has provided a rapid and simple method for plant pathologists to identify the species and phenetic grouping of tissue isolates from Cytospora cankers on stone and pome fruit trees. For example, restriction digests with HinfI or HpaII successfully distinguished each phenetic group and the species L. persoonii sensu stricto, L. parapersoonii sp. nov., and L. cinctum, among a diverse collection of isolates (Table II). RFLP analysis also revealed considerable variation among isolates of L. persoonii sensu stricto, the most ubiquitous canker pathogen of peaches, world-wide. The improved knowledge of pathogen variability should improve the choice of a comprehensive array of isolates for screening peach germplasm for disease-resistance.

It was a serendipitous discovery that introns were present in the SSU rDNA of L. cinctum PG 4 and PG 5. Following screening of many isolates from stone fruit and pome fruit trees, we discovered that the introns were not in the SSU rDNA of L. cinctum PG 6 or in L. persoonii sensu stricto (formerly, PG 1) and L. parapersoonii sp. nov. (formerly, PG 2 and PG 3). However, this screening method did not exclude the possibility that the introns could reside elsewhere in the genome of these isolates. The presence of the introns was useful in the rapid identification of L. cinctum PG 4/PG 5 isolates cultured from Cytospora cankers on P. persica, where teleomorphs were absent, anamorphs were indistinguishable, and cultural characteristics were similar to L. parapersoonii sp. nov (Wang et al 1998Citation). In studies on maternal lineages and population genetics of Cytospora in Michigan orchards, screening for the introns (both together) by PCR amplification with primers NS21UCB/NS22UCB was highly expedient for identifying cultures of L. cinctum PG 4/PG 5 (Wang et al 1998Citation). This technique also was successfully utilized in studies of Cytospora canker on Prunus spp. in South Africa (Smit and Adams 1999Citation). Additionally, understanding the secondary structure of the introns should be useful for designing primers to PCR amplify the variable loop structures of the P1 and P5 base-paired regions. Such primers could be used for sequence-characterized markers in studies of population genetics, or for studies on the evolution of Group 1 introns in ascomycetous fungi.

Characterization of the introns by sequence homology added new information to the study of the structure, function, and evolution of introns because L. cinctum intron 2 was of an unknown subgroup of Group 1 introns. Both L. cinctum intron 1 and intron 2 were related to introns in other fungi. Intron 1 occurred in position 943 of the SSU rDNA and was quite similar in DNA sequence to the introns of the homobasidiomycetes Lentinellus P. Karst. and Panellus P. Karst (Hibbett 1996Citation). Related introns also occurred in remarkably distant and unusual life forms, such as in the genome of an algal virus (dbjD17367, Yamada et al 1994Citation).

The occurrence of two introns in the L. cinctum PG 4/PG 5 population and their absence in L. cinctum PG 6 was interesting because the ITS rDNA sequence was similar for these PGs, and therefore, presumably, little time had passed since divergence of the PGs. However, it has been reported that fungal isolates in a local population differed in the number of introns in the SSU rDNA (DePriest 1993Citation). Collins and Lambowitz (1983)Citation reported that any Group 1 intron present in one isolate might be absent from the same location in another isolate. Also, closely related introns have been reported to be located in the same site in distantly related fungi (Li 1995Citation), or located in different positions in the same gene in closely related species (Li 1995Citation), or located in different genes in the same genome (Bonitz et al 1980Citation). With intron homing, an intron could be inserted into an intron-lacking rDNA repeat as a result of interaction with an intron-containing rDNA repeat from another nucleus during sexual reproduction. Precise deletion of introns can occur by reverse transcription and homologous recombination between an intron-lacking and an intron-containing sequence (Hibbett 1996Citation). Presence of the introns in the SSU of L. cinctum PG4/5 appeared to be a stable characteristic at least in our collection of isolates from the Lake States region (including Ontario). We have not been able to locate other geographic sources of these fungi and the identification of canker pathogens as L. cinctum is often in error in the literature (Surve-Iyer 1995Citation). Sequence variation within intron 1 and intron 2 among different isolates of L. cinctum is being currently investigated to determine whether intron sequence might be useful for studies of phylogenetics, population structure, and intron evolution.


    ACKNOWLEDGMENTS
 
Mary Berbee first identified a Group 1 intron in one of our isolates of L. cinctum and this is reported in Gargas et al 1995Citation. The authors wish to express special thanks to John W. Taylor for providing us with access to his laboratory, supplies, materials, and especially for his comradeship. This research was partially funded by USDA 91-37303-6389 AES. We are grateful to Mark Garland and Patricia Eickel for translating the new species description into the Latin diagnosis. We wish to thank Robin R. Gutell and Andreas Low for constructing the representations of the secondary structure of the introns. Additionally, we wish to thank T. Michailides, A. Jones, T. Proffer, D. Richie and E. Endert-Kirkpatrick, R. Spotts, A. Biggs, and R. Copeman for providing us with cultures of Cytospora from stone and pome fruit trees.


    FOOTNOTES
 
1 Corresponding author, gadams{at}msu.edu Back

Accepted for publication March 21, 2002.


    LITERATURE CITED
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 TAXONOMY
 DISCUSSION
 LITERATURE CITED
 
Adams GC., 1995 Frequent and rapid evolution of host range among species of Cytospora, canker pathogens of trees. Phytopathology 85:1129.

———, Hammar SA, Iezzoni A., 1989 Optimum sample size for detecting virulence differences in Leucostoma isolates from peach. Pl Dis 73:754-759

———, ———, Proffer T., 1990 Vegetative compatibility in Leucostoma persoonii. Phytopathology 80:287-291

———, Taylor JW., 1993 Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in Leucostoma and Valsa. Inoculum 44:17.

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ., 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl Acids Res 25:3389-3402

Berbee ML, Taylor JW., 1992a Two Ascomycete classes based on fruit-body characters and ribosomal DNA sequence. Mol Biol Evol 9:278-284[Abstract]

———, ———. 1992b Convergence in ascospore discharge mechanism among pyrenomycete fungi based on 18S ribosomal RNA gene sequence. Mol Phylogenet Evol 1:59-71[Medline]

Biggs AR., 1989 Integrated approach to controlling Leucostoma canker of peach in Ontario. Pl Dis 73:869-874

Bonitz SG, Coruzzi G, Thalenfeld BE, Tzagoloff A, Macino G., 1980 Assembly of the mitochondrial membrane system. Structure and nucleotide sequence of the gene coding for subunit 1 of yeast cytochrome oxidase. J Biol Chem 255:11927-11941[Abstract/Free Full Text]

Brow MAD., 1990 Sequencing with Taq DNA polymerase. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols, a guide to methods and applications. San Diego, California: Academic Press. p 189–196

Bruns T, White TJ, Taylor JW., 1991 Fungal molecular systematics. Annu Rev Ecol Syst 22:525-564

Cabot EL, Beckenbach AT., 1989 ESEE—The EyeBall Sequence Editor. CABIOS 5:233-234[Free Full Text]

Cech TR., 1988 Conserved sequences and structures of Group 1 introns: building an active site for RNA catalysis—a review. Gene 73:259-271[Medline]

———, Damberger SH, Gutell RR., 1994 Representation of the secondary and tertiary structure of group I introns. Nature Structural Biol 1:273-280[Medline]

Chang LS, Iezzoni AF, Adams G., 1991 Heritability of Leucostoma persoonii canker resistance among diverse peach genotypes. HortSci 26:60-62[Abstract/Free Full Text]

———, ———, ———, Howell GS., 1989 Leucostoma persoonii tolerance and cold hardiness among diverse peach genotypes. J Am Soc Hortic Sci 114:482-485

Collins RA., 1988 Evidence of natural selection to maintain a functional domain outside of the ‘core’ in a large subclass of Group 1 introns. Nucl Acids Res 16:2705-2715[Abstract/Free Full Text]

———, Lambowitz AM., 1983 Structural variation and optional introns in the mitochondrial DNAs of Neurospora strains isolated from nature. Plasmid 9:53-70[Medline]

Damberger SH, Gutell RR., 1994 A comparative database of group I intron structures. Nucl Acids Res 22:3508-3510[Abstract/Free Full Text]

Défago G., 1935 De quelques Valsées von Höhnel parasites des arbres à noyau dépérissants. Beträge zur Kryptogamenflora der Schweiz 8:1-111

DePriest PT., 1993 Small subunit rDNA variation in a population of lichen fungi due to optional group I introns. Gene 134:67-71[Medline]

Felsenstein J., 1985 Confidence intervals on phylogenies: an approach using bootstrap. Evolution 39:783-791

———. 1997 PHYLIP (phylogeny inference program), Version 3.5. Seattle, Washington: Department of Genetics SK-50, University of Washington

Gargas A, DePriest PT, Taylor JW., 1995 Positions of multiple insertions in SSU rDNA of lichen-forming fungi. Mol Biol Evol 12:208-218[Abstract]

———, Taylor JW., 1992 Polymerase chain reaction (PCR) primers for amplifying and sequencing nuclear SSU rDNA from lichenized fungi. Mycologia 84:589-592

Grove WB., 1935 British stem- and leaf-fungi (Coelomycetes). Vol. 1. Cambridge, Massachusetts: Cambridge University Press. 488 p

Gunter LS., 1934 Materials for a monograph of the genus Cytospora. Acta Inst Bot Acad Sci URSS 2:411-484

Gutell RR., 1993 Collection of small subunit (16S- and 16S-like) ribosomal RNA structures. Nucl Acids Res 21:3051-3054[Free Full Text]

Gvritishvili MN., 1982 The fungal genus Cytospora in the USSR. Tbilici: Izdatelstve Sabchota Sakarstvelo. 214 p. (in Russian)

Gyllensten UB, Erlich HA., 1988 Generation of single stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLADQ locus. Proc Natl Acad Sci USA 85:7652-7656[Abstract/Free Full Text]

Hedges SB., 1992 The number of replications needed for accurate estimation of the bootstrap P value in phylogenetic studies. Mol Biol Evol 9:366-369[Medline]

Hibbett DS., 1996 Phylogenetic evidence for horizontal transmission of group I introns in the nuclear ribosomal DNA of mushroom-forming fungi. Mol Biol Evol 13:903-917[Abstract]

Issakaines J, Jalaava J, Eerola E, Campbell CK., 1997 Relatedness of Pseudallescheria, Scedosporium and Graphium pro parte based on SSU rDNA sequences. J Med Vet Mycol 35:389-398[Medline]

Kelly KL, Judd DB., 1955 The ISCC-NBS Method of Designating Colors and a Dictionary of Color Names, National Bureau of Standards Circular 553. Washington, D.C.: U.S. Government Printing Office. 158 p

Kern H., 1955 Taxonomic studies in the genus Leucostoma. Pap Mich Acad Sci Arts Letters 40:9-22

Kobayashi T., 1970 Taxonomic studies of Japanese Diaporthaceae with special reference to their life-histories. Tokyo, Japan: Ringyo Shikenjo Kenkyu Hokoku 226. 242 p

Koske RE, Tessier B., 1983 A convenient permanent slide mounting medium. Newslett Mycol Soc Am 34:59.

Lee SB, Taylor JW., 1990 Isolation of DNA from fungal mycelia and single spores. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols, a guide to methods and applications. San Diego, California: Academic Press. p 282–287

Li Y., 1995 Molecular characterization and evolution of mitochondrial intons within the large subunit ribosomal RNA genes of Suillus [PhD Thesis]. Berkeley, California: University of California. 141 p

Michel F, Westhof E., 1990 Modelling of the three dimensional architecture of Group 1 catalytic introns based on comparative sequence analysis. J Mol Biol 216:585-610[Medline]

———, Jacquier A, Dujon B., 1982 Comparison of fungal mitochondrial introns reveals extensive homologies in RNA secondary structure. Biochime 64:867-881[Medline]

Miller JC., 1990 RESTSITE: programs for analyzing restriction site or fragment data. Version 1.2. Cambridge, Massachusetts: Whitehead Institute

Nei M, Miller JC., 1990 A simple method of estimating average number of nucleotide substitutions within and between populations from restriction data. Genetics 125:873-879[Abstract]

Nei M, Tajima F., 1983 Maximum likelihood estimation of the number of nucleotide substitutions from restriction site data. Genetics 105:207-217[Abstract/Free Full Text]

Page RD., 1996 TreeView: an application to display phylogenetic trees on personal computers. CABIOS 12:357-358[Free Full Text]

Proffer T, Jones AL., 1989 A new canker disease of apple caused by Leucostoma cinctum and other fungi associated with cankers of apple in Michigan. Pl Dis 73:508-514

Saccardo PA., 1882–1931 Sylloge Fungorum. Pavia, Italy: Typis Seminarii. Vol. 1–25

Sambrook J, Fritsch EF, Maniatis T., 1989 Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, New York: Cold Spring Harbor Press. Vol. 1–3

Sanger F, Nicklen S, Coulson AR., 1977 DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467[Abstract/Free Full Text]

Simmons MP, Ochoterena H., 2000 Gaps as characters in sequence-based phylogenetic analyses. Syst Biol 49:369-381[Medline]

Smit WA, Adams GC., 1999 Identification of Leucostoma species isolated from apple and stone fruit cultivars in South Africa. Phytopathology 89:S73.

Surve-Iyer RS, Adams GC, Iezzoni AF, Jones AL., 1995 Isozyme detection and variation in Leucostoma species from Prunus and Malus. Mycologia 87:471-482

Swofford DL., 2000 PAUP: phylogenetic analysis using parsimony. Version 4.0 Beta. Sunderland, Massachusetts: Sinauer Associates

———, Maddison WP., 1987 Reconstructing ancestral character states under Wagner parsimony. Math Biosci 87:199-229

Tibayrenc M., 1997 Are Candida albicans natural populations subdivided?. Trends Microbiol 5:253-254[Medline]

———, Kjellberg F, Arnaud J, Oury B, Brenière SF, Dardé M, Ayala FJ., 1991 Are eucaryotic microorganisms clonal or sexual? A population genetics vantage. Proc Natl Acad Sci USA 88:5129-5133[Abstract/Free Full Text]

———, ———, Ayala FJ., 1990 A clonal theory of parasitic protozoa: the population structures of Entamoeba, Giardia, Leishmania, Naegleria, Plasmodium, Trichomonas, and Trypanosoma and their medical and taxonomical consequences. Proc Natl Acad Sci USA 87:2414-2418[Abstract/Free Full Text]

Thompson JD, Higgins DG, Gibson TJ., 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucl Acids Res 22:4673-4680[Abstract/Free Full Text]

von Höhnel F., 1917 System der Diaportheen. Ber Deutsch Bot Ges 35:631-638

Wang D, Iezzoni A, Adams G., 1998 Genetic heterogeneity of Leucostoma species in Michigan peach orchards. Phytopathology 88:376-381[Medline]

Wensley RN., 1964 Occurrence and pathogenicity of Valsa species and other fungi associated with peach canker in southern Ontario. Can J Bot 42:841-857

White TJ, Bruns TD, Lee SB, Taylor JW., 1990 Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols, a guide to methods and applications. San Diego, California: Academic Press. p 315–322

Yamada T, Tamura K, Aimi T, Songsri P., 1994 Self-splicing group 1 introns in eukaryotic viruses. Nucl Acids Res 22:2532-2537[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
MycologiaHome page
P. M. Letcher, M. J. Powell, J. G. Chambers, and W. E. Holznagel
Phylogenetic relationships among Rhizophydium isolates from North America and Australia
Mycologia, November 1, 2004; 96(6): 1339 - 1351.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adams, G. C.
Right arrow Articles by Iezzoni, A. F.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Adams, G. C.
Right arrow Articles by Iezzoni, A. F.
Agricola
Right arrow Articles by Adams, G. C.
Right arrow Articles by Iezzoni, A. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS