| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Centro de Recursos Microbiológicos, Secção Autónoma de Biotecnologia, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica, Portugal
M. Weiß
Universität Tübingen, Institut für Biologie I, Lehrstuhl Spezielle Botanik und Mykologie, Auf der Morgenstelle 1, D-72076 Tübingen, Germany
M. Gadanho
Centro de Recursos Microbiológicos, Secção Autónoma de Biotecnologia, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica, Portugal
R. Bauer
Universität Tübingen, Institut für Biologie I, Lehrstuhl Spezielle Botanik und Mykologie, Auf der Morgenstelle 1, D-72076 Tübingen, Germany
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Two new genera, Bulleribasidium and Papiliotrema, and three new species, B. oberjochense, P. bandonii and Fibulobasidium murrhardtense are described. An integrated analysis of morphological, ultrastructural, physiological, and molecular data indicates that the new taxa belong to the Tremellales (Basidiomycota). Relevant characteristics of the new genera and species are discussed and compared with those of closely related taxa.
Key words: dimorphic heterobasidiomycetes, molecular phylogeny, systematics, 26S rDNA, Tremellales, ultrastructure
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
) supplemented with 500 ppm chloramphenicol and incubated at room temperature. Light microscopy studies were performed after growth of the cultures on the same medium without antibiotic at room temperature. In some cases wheat grain agar was used. Wheat grains were soaked in water overnight, drained and then autoclaved. Approximately 20–30 grains were placed in the center of each plate of 2% water agar while the agar was still liquid.
Living and untreated material of different developmental stages was studied by phase contrast microscopy with an Olympus BX50 photomicroscope. For transmission electron microscopy, samples taken directly from the fruitbodies or from cultures grown in the same way as for light microscopy were fixed overnight in 2% glutaraldehyde in 0.1 M sodium cacodylate buffer at pH 7.2. Following six transfers in 0.1 M sodium cacodylate buffer, the material was post-fixed in 1% osmium tetroxide in the same buffer for 2 h in the dark, washed with distilled water, and stained with 1% aqueous uranyl acetate for 1 h in the dark. After five washes with distilled water, samples were dehydrated in acetone, using 10 min changes at 25% (v/v), 50%, 70%, and 95%, and three times in 100% acetone. The material was embedded in Spurr's (1969) plastic. Serial sections (65–75 nm) were cut with a Reichert–Jung Ultracut E (Leica, Nußloch), equipped with a diamond knife. Sections were mounted on Formvar-coated single slot copper grids, stained with lead citrate (Reynolds 1963) at room temperature for 3–5 min, and washed again with water. The thin sections were examined at 80 kV with a Zeiss EM 109 transmission electron microscope.
Physiological characterization of the yeast stages was performed according to the techniques described by Yarrow (1998).
For determination of molar % G + C and the extent of DNA–DNA reassociation, total genomic DNA was extracted and purified using the procedures described by Sampaio et al (2001). The nuclear DNA base composition was determined following the method of Marmur and Doty (1962) with a Gilford Response UV–VIS Spectrophotometer and its Thermal Programing software, using nDNA from Candida parapsilosis (Ashford) Langeron & Talice PYCC 2545T (CBS 604) (mol% G + C = 40.2%) as reference. For DNA–DNA reassociation experiments the same instrument was used and the methods of Kurtzman et al (1980) were followed.
The D1/D2 region of the nuclear gene coding for the 26S rDNA of the new taxa was sequenced as described by Weiß and Oberwinkler (2001) and compared with sequences of selected species usually classified in the Tremellales (Table I). Mitosporic taxa were also included in the analysis. Instead of the forward primer NL1, a modified primer NLMW1 (5' TCAATAAGCGGAGGAAAAGA 3') was used for PCR and cycle sequencing in some cases. An alignment of 689 bp was produced with the MEGALIGN module of the Lasergene package (DNASTAR, Inc. 1997) followed by manual corrections using Se–Al (Rambaut 1996). In the final alignment, positions 560–620 of Bullera miyagiana were coded as missing data because this part of the sequence was only dubiously alignable to the remaining species. PAUP* 4.0, versions b4a and b8a (Swofford 2000), was used to perform phylogenetic analyses following the methods of minimum evolution (Kidd and Sgaramella–Zonta 1971; 1000 rounds of heuristic search using starting trees obtained by random addition and subsequent TBR branch swapping), maximum likelihood (Felsenstein 1981; TBR branch swapping starting with a neighbor-joining tree), and maximum parsimony (e.g., Fitch 1971; 1000 rounds of heuristic search using starting trees obtained by random addition and subsequent TBR branch swapping; gaps treated as missing data). Each of these analyses was performed with the MULTREES and steepest descent options in effect. A DNA substitution model including parameter values for maximum likelihood analysis was estimated using a series of likelihood ratio tests as implemented in Modeltest 3.04 (Posada and Crandall 1998); the resulting model was also used to derive maximum likelihood distances for the minimum evolution analysis (Swofford et al 1996). Minimum evolution and maximum parsimony analyses were combined with the bootstrap (Felsenstein 1985; 1000 bootstrap replicates, each with 10 rounds of heuristic search using TBR branch swapping on starting trees obtained by random addition, MULTREES option in effect). GenBank accession numbers of the sequences determined for this study and of the other sequences used in the molecular phylogenetic analyses are given in Table I. The sequence alignment and the minimum evolution tree obtained are deposited in TreeBASE (http://treebase.org), study accession no. S767; matrix accession no. M1214.
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Fungi dimorphi. Basidiomata absentia. Basidia plerumque transverse, interdum longitudinaliter septata, solitaria vel paucis aggregata, fibulata. Basidiosporae globosae, ab apicibus sterigmatum tubularium expelluntur, gemmis vel repetitione germinant. Hyphae hyalinae, haustoriis tremelloideis. In statu unicellulari ballistoconidiis et gemmis ex apicibus stipitum brevium oriundis ad genus Bullerae Derx pertinent.
Dimorphic. Basidiocarps absent. Basidia typically transversally septate, occasionally longitudinally septate, arranged in small clusters or isolated, clamped. Basidiospores globose, rotationally symmetrical, produced at the apex of tubular sterigmata and forcibly discharged, germinating by budding or repetition. Hyphae hyaline, clamped, with tremelloid haustoria. Anamorphic stage produces ballistoconidia and budding yeast cells, normally at the end of short stalks, and is classified in the genus Bullera Derx.
Typus generis: Bulleribasidium oberjochense in opere ipso descripta.
Etymology. "Bulleri-" refers to the anamorphic yeast genus Bullera; "-basidium" refers to the basidiomycetous nature of this fungus.
Fungus dimorphus, homothallicus. Cultura in agaro: Basidia singularia vel paucis aggregata, 2 cellulata, plerumque cylindracea, transverse septata, interdum globosa, longitudinaliter septata, 4–8 x 10–16 (–20) µm. Basidiosporae globosae, 5–7 µm diametro, pariete tenui, ex apicibus sterigmatum 1–3 x 8–15 (–20) µm longorum expelluntur, gemmis vel repetitione germinant. In statu unicellulari ad Bulleram variabilem Nakase et Suzuki pertinet. In malto-fermento-peptono-agaro post 7 dies cellulae ovales ad pyriformes, gemmas in apicibus stipitum brevium efferunt; ballistoconidia globosa (2–4 µm diametro) ad subglobosa (3–4 x 4–5 µm) in apicibus sterigmatum 5–8 µm longorum oriunda. Cultura in striis post unum mensem luteola, hebes, levis ad leviter verrucosa, mycelio e margine ad centrum crescente. Hyphae 2–3 µm in diametro, septis fibulis imperfectis, doliporis. Haustoria filamentosa, pedunculis globosis ad elongatis.
Dimorphic. Basidia produced on solid laboratory media, arranged in small clusters or isolated, two-celled, normally transversally septate and cylindrical, occasionally globose and longitudinally septate, measuring 4–8 x 10–16 (–20) µm (Figs. 2, 3, 14–18, 20, 21). Basidiospores globose (5–7 µm diam.), thin-walled, ejected from sterigmata [1–3 x 8–15 (–20) µm] and germinating by budding or repetition (Figs. 3, 19). The unicellular stage is classified in Bullera variabilis Nakase & Suzuki by conventional taxonomic criteria. On MYP agar after one week, yeast cells oval to pyriform 4–6 x 6–8 (–10) µm (Fig. 1) producing daughter cells at the end of short stalks; mature ballistoconidia globose (2–4 µm in diameter) to subglobose (3–4 x 4–5 µm) produced at the end of 5–8 µm long sterigmata (Fig. 5). Streak culture after one month yellowish–cream, dull, surface smooth to slightly verrucose with mycelium developing from the margins. Homothallic. Mycelium develops from single yeast cells (Fig. 1). Hyphae normally 2–3 µm in diameter, with incomplete clamp connections (Fig. 1) and with dolipores (Figs. 31, 32). Haustoria formed and able to attach to hyphae of culture contaminants like Cladosporium spp. (Figs. 4, 22). Haustorial cells globose or elongated and haustorial filaments branched or unbranched (Fig. 4). The biochemical and physiological properties of B. oberjochense are depicted in Table II.
|
|
|
|
|
|
Origin, type and deposits. Two cultures of the fungus (ZP 394 and ZP 395) were isolated by J.P. Sampaio in October 1997 from the fruitbody of Tulasnella helicospora Raunkiaer collected in Oberjoch, 1200–1400 m, Bavarian Alps, Germany. Live cultures have been deposited in the Portuguese Yeast Culture Collection (PYCC) as PYCC 5741 (= ZP 394) (ex-type) and PYCC 5742 (= ZP 395). Dried specimens (HOLOTYPE) have been deposited in PYCC herbarium (ZP-97-01).
Bulleribasidium oberjochense is able to complete its life cycle in culture media. On MYP agar single yeast cells originate hyphae with incomplete clamp connections and haustoria after 4–7 d. Globose to subglobose basidial initials can be detected after 6–8 wk. At this stage, transfer of agar blocks to 2% water agar enhances basidial development and approximately 10 d after transfer septate basidia can be observed. The formation of sterigmata and basidiospores occurs a few days later. The production of sexual structures seems to be stimulated in cultures contaminated with deuteromycetes such as Cladosporium spp.
Fungi dimorphi. Basidiomata minuta, pustuliformia. Basidia transverse septata, fibulata. Basidiosporae allantoideae, ab apicibus sterigmatum expelluntur, gemmis, repetitione vel hyphis germinant. Hyphae hyalinae, fibulatae, haustoriis tremelloideis. In statu unicellulari ad genus Cryptococci Vuillemin pertinent.
Dimorphic. Basidiocarps minute. Basidia transversally septate. One sterigma produced from each basidial compartment. Basidiospores forcibly discharged, germinating by budding, repetition or formation of hyphae. Hyphae hyaline, with clamp connections and haustoria. Anamorphic stage classified in the genus Cryptococcus Vuillemin.
Typus generis: Papiliotrema bandonii in opere ipso descripta.
Etymology. "Papilio"— refers to the butterfly-like shape of the conidia, —"trema" refers to the tremellaceous nature of this fungus. The compound has feminine gender.
Fungus dimorphus. Basidiomata minuta, 0.5 mm diametro, tremelloidea, atra, singularia vel interdum confluentia. Fructificatio saepe conidiogena. Fructificationum conidiogenarum hyphae fibulatae, brunnescentes, parietibus crassis, dense aggregatae, hyphis fructificationum basidiogenarum latiores, haustoriis tremelloideis. Septa hypharum doliporis parenthesomate cupulato. Zygoconidia ex duabus cellulis conidiogenis terminalibus vicinis oriuntur, compartimentis globosis ad subglobosis (2–) 2.5–3.5 x 3–5 µm, tubulo 1–2 µm longo iunctis. Basidia sparsa, transversaliter 3 septata, 3–5 x (15–) 20–30 µm, singularia vel paucis aggregata. Hyphae basidiogenae parietibus tenuibus, fibulatae, 1–1.5 µm diametro. Basidiosporae allantoideae (2–3 x 8–12 µm), parietibus tenuibus, ex apicibus sterigmatum (3–) 5–10 µm longorum expelluntur, gemmis, repetitione vel hyphis germinant. In statu unicellulari ad genus Cryptococci Vuillemin pertinet. In malto-fermento-peptono-agaro post 7 dies cellulae ellipsoideae (2–) 3–4 x (4–) 6–10 µm. Cultura in striis post unum mensem cremea, nitida, levis, textura butyracea.
Basidiocarps minute (0.5 mm in diameter) soft, black colored, normally isolated, occasionally becoming confluent (Fig. 6). Fructifications often conidial. Conidial stage composed of clamped hyphae, wider than those of the basidial stage (Figs. 7, 24–27). Hyphae of the conidial stage have tremelloid haustoria and become thick-walled, brownish and densely aggregated with age (Fig. 7). Dolipores with cupulate parenthesomes present (Figs. 33, 34). Zygoconidia produced terminally by two contiguous cells in the conidial hyphae (Figs. 7, 27). Compartments of the zygoconidia globose to subglobose, (2–) 2.5–3.5 x 3–5 µm, united by a tube measuring 1–2 µm long (Figs. 7, 23). Conidial stage also produced in wheat grain agar, after approximately one month but devoid of thick brownish hyphae. Basidia only observed in basidiocarps collected in nature, transversally 3 septate, sometimes with fewer septa, measuring 3–5 x (15–) 20–30 µm, arranged in small clusters or isolated (Figs. 8, 29, 30). In some cases basidia are formed at the end of a stalk measuring 1–1.5 x 15–30 µm. Hyphae that form basidia thin-walled, clamped and narrow (1–1.5 µm in diameter). Basidiospores allantoid (2–3 x 8–12 µm), thin-walled, produced at the end of sterigmata measuring (3–) 5–10 µm long and forcibly discharged (Fig. 8). Basidiospores germinate by budding, repetition or by formation of mycelium. Budding yeast stage composed of ellipsoidal cells measuring (2–) 3–4 x (4–) 6–10 µm on MYP agar after one week (Fig. 9) and classified in the genus Cryptococcus Vuillemin. Streak culture after one month on MYP agar cream-colored, surface glossy and smooth, texture butyrous. The biochemical and physiological characteristics of P. bandonii are given in Table II.
Etymology. "bandonii" refers to Prof. R. J. Bandoni, who has made notable contributions to the systematics of the Tremellales.
Origin, type, and deposits. Fruiting bodies from P. bandonii were found associated with pyrenomycetous ascomycetes at the base of the inflorescences of the elephant grass Cortaderia selloana (Schult.) Aschers. & Graebn. Dried specimens from this collection made in Dec 1998 in Quinta dos Pinheiros, Sesimbra, Portugal (HOLOTYPE) have been deposited in the PYCC herbarium (ZP-99-02). From the same collection, a culture was obtained using the ballistospore fall method. The culture (ex-type) was deposited in the Portuguese Yeast Culture Collection as PYCC 5743 (= ZP 405).
This fungus formed fruiting structures at the base of inflorescences of Cortaderia selloana kept in a moist chamber for approximately two weeks at room temperature. Several collections were made during the winters of 1998 and 1999. No fruiting structures were detected at the time the material was collected. In some cases the fruiting structures that developed after incubation in a moist chamber seemed to include only the conidial stage since no basidia could be found in repeated microscopic examinations carried out between the first and eighth week of incubation.
Fungus dimorphus. Basidiomata resupinata, translucentia, mucosa, in ramis putridis. Hyphae hyalinae, 1.5–3 µm latae, fibulatae, sine haustoriis tremelloideis. Septa hypharum doliporo parenthesomate cupulato. Conidia 1–1.5 x 2–3 µm, ellipsoidea ad subglobosa, ex hyphis conidiogenis terminaliter vel intercalariter oriunda, gemmis germinant. Hyphae fertiles tortae. Probasidia globosa ad cylindracea. Basidia globosa (10–) 12–17 µm diametro, plurimum 4 cellulata, singularia vel aggregata. Basidiosporae sessiles, fusiformes ad ellipsoideae, 6–8 x 18–23 µm, gemmis germinant. In statu unicellulari ad genus Cryptococci Vuillemin pertinet. In malto-fermento-peptono-agaro post 7 dies cellulae ellipsoideae, (2–) 3–4 x 5–9 µm. Cultura in striis post unum mensem albida, nitida, levis, textura butyracea.
Dimorphic. Basidiocarps resupinate, forming a translucent slimy mass at the surface of an unidentified decomposing tree branch. In the original collection the basidiome was old, approximately 5 cm long and 2 cm wide, with many basidia empty or collapsed. Microscopic details are based on observations of the material collected in the field and on a culture derived from it. Hyphae hyaline, narrow (1.5–3 µm), clamped and without haustoria. The septal pore is a dolipore with cupulate parenthesomes (Fig. 35). Conidiogenesis is terminal or intercalary in the hyphae and results in the production of numerous small (1–1.5 x 2–3 µm) ellipsoidal to subglobose yeast cells (Fig. 13). Basidia initials globose to cylindrical, sometimes with irregular shape (Fig. 11). Fertile hyphae twisted, forming tortuous masses at the base of the basidia (Figs. 11, 12). Mature basidia globose, (10–) 12–17 µm in diameter, normally 4-celled, singly or in clusters, sometimes detached from their hyphae (Fig. 12). Basidiospores sessile, fusiform to ellipsoid, usually abruptly narrowed at both ends, measuring 6–8 x 18–23 µm and germinating by budding (Fig. 12). The unicellular stage is classified in the genus Cryptococcus Vuillemin. Yeast cells predominantly ellipsoid, (2–) 3–4 x (4–) 5–9 µm (MYP agar after one week; Fig. 10). Streak culture after one month on MYP agar whitish, surface glossy and smooth, texture butyrous. Probably heterothallic since single colony isolates derived from the initial culture did not regenerate the filamentous stage. The biochemical and physiological characteristics of F. murrhardtense are given in Table II.
|
Origin, type and deposits. Basidiocarps of this species were collected in June 1999 at Bromersberg, Murrhardt, Baden–Württemberg, Germany. Since the material collected in the field was in poor condition and the entire life cycle can be observed in culture, a portion of a sporulating culture (ZP 415) that was obtained by streaking a small piece of a basidiocarp on MYP agar with chloramphenicol, was preserved lyophilized (HOLOTYPE). Dried specimens from the field collection (PARATYPE) have been deposited in PYCC herbarium (ZP-99-05). The living culture (ex-type) derived from the field collection was deposited in the Portuguese Yeast Culture Collection as PYCC 5744 (= ZP 415).
Basidiomes of F. murrhardtense were found on a rotten branch of an unidentified tree and formed a translucent slimy mass. Many basidia were mature, empty and in some cases collapsed. Large basidiospores, resembling in shape those of the other species of Fibulobasidium, were found still attached to the basidia or already released. These propagules looked viable under the light microscope and we believe that the culture obtained by streaking pieces of the fruitbody on solid culture medium resulted from their germination. In the first days of incubation on MYP agar the culture is composed mainly of yeast cells but after two weeks mycelium with clamp connections can be observed. Basidia develop after incubation for approximately one month at room temperature.
DNA sequence analyses.
The DNA substitution model estimated by Modeltest 3.04 (Posada and Crandall 1998) using a series of likelihood ratio tests is a modification of the model of Tamura and Nei (1993) involving equal base frequencies, three types of nucleotide substitutions (transversions, A–G, C–T; with rate matrix coefficients 1.0000, 3.6487, and 6.0269, respectively), a proportion of 0.2887 of invariable sites, and substitution rates following a gamma distribution with an 
parameter of 0.5256 (see Swofford et al 1996 for explanations of these parameters). A phylogenetic tree based on the minimum evolution method is presented in Fig. 36. Maximum parsimony and maximum likelihood methods generated essentially the same topology (trees not shown).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
), thus resembling those of Tremella, the basidia of B. oberjochense are usually transversally septate and cylindrical. Our molecular phylogenetic analyses indicate that B. oberjochense is not closely related to Bu. albus (Fig. 36). With respect to their ecology, both taxa are probably mycoparasitic because they produce tremelloid haustoria. Moreover, in B. oberjochense we have gathered evidence of activity against hyphae of a culture contaminant of the genus Cladosporium. Bulleromyces is usually found in the phylloplane whereas we isolated Bulleribasidium from the basidiocarp of a heterobasidiomycete. Fruiting bodies are not known in either taxon. At the sub-cellular level, Bu. albus has dolipores with distinct cupulate parenthesomes (Boekhout et al 1991). In B. oberjochense we were able to detect dolipores having poorly developed parenthesome–like elements in the vicinity of the septal pore (Figs. 31, 32). Further studies are needed to elucidate the nature of such structures. In Bull. variabilis, the closest relative of B. oberjochense (Fig. 36), typical cupulate parenthesomes have been reported (Boekhout et al 1991). Bulleribasidium oberjochense was initially identified as Bullera variabilis, based on standard yeast identification criteria. The occurrence of mating among strains of Bull. variabilis (including the type strain of this species) was reported by Boekhout et al (1991) but, besides production of clamped mycelium and haustoria, basidial development was not observed. Since we detected the complete sexual cycle in our new strains of Bull. variabilis, the question arose of whether or not our findings corresponded to the situation reported by Boekhout et al (1991). To elucidate this issue we repeated the mating experiments carried out by Boekhout and co-workers using exactly the same strains (CBS 7347T and CBS 7367) but, unfortunately, no mating response was detected. A second approach consisted of comparing the D1/D2 regions of the 26S rDNA sequences of the type strain of Bull. variabilis (CBS 7347T) and the type strain of B. oberjochense (Fig. 36). It can be observed that although the two strains are closely related their sequences are not identical. In fact, they differ by five nucleotides. To examine the relationship between the two taxa, we also carried out DNA–DNA reassociation experiments using both type strains and obtained homology values ranging between 28 and 33%, which indicate that B. oberjochense does not represent the sexual stage of Bull. variabilis. However, in spite of these differences, the two species are not distinguishable if nutritional data alone are considered (Table II). With respect to the latter species, the phylogenetic position of strain CBS 7354 in the tree of Fig. 36 contradicts its phenotypic identification as Bull. variabilis and indicates that this species is heterogeneous.
Among the taxa that belong to the Tremellales, Papiliotrema shares an unusual conidial type with Trimorphomyces Bandoni & Oberwinkler and Sigmogloea Bandoni & Krug. Besides a filamentous and a unicellular budding stage, a two-celled, H-shaped phase is present (Oberwinkler and Bandoni 1983, Bandoni and Krug 2000 and Figs. 7, 23, 27). In some species of Syzygospora Martin/Christiansenia Hauerslev paired conidia are also formed but they fuse completely before release to form a dikaryotic cell and therefore H–shaped conidial structures are not observed (Oberwinkler and Bandoni 1982, Oberwinkler et al 1984, Chen et al 1998). Also in Trimorphomyces, butterfly-like conidia are known to conjugate (Oberwinkler and Bandoni 1983) but such a phenomenon was not detected in Papiliotrema. Zygoconidia are also known in taxa not related to the Tremellales, like the urediniomycetous Zygogloea gemellipara P. Roberts (Roberts 1994) and Colacogloea papilionacea Kirschner & Oberwinkler (Kirschner and Oberwinkler 2001). Consequently, it seems that among the fungi traditionally designated as heterobasidiomycetes and even among the Tremellales, the evolution of papilionate conidia occurred independently in several lineages. In fact, our molecular analyses have not shown a close affinity between Papiliotrema bandonii and Trimorphomyces papilionaceus CBS 444.92 (Fig. 36). It should be noted that strain CBS 445.92, labeled as T. papilionaceus, occupies a position different from that of CBS 444.92 and 71 different nucleotides were detected between them. Since CBS 444.92 behaves as a mating strain of T. papilionaceus (producing clamped mycelium and zygoconidia when mated with CBS 446.92) and CBS 445.92 does not, we are presently uncertain about the correct identity of CBS 445.92.
Among the zygoconidia-producing taxa of the Tremellales, several features allow their practical discrimination. Papiliotrema bandonii can be distinguished from Sigmogloea tremelloidea based on: (i) the color of the basidiocarps, blackish in the former and white in the latter; (ii) the presence of thick-walled and brownish hyphae in the basidiocarps of P. bandonii, which do not occur in S. tremelloidea; (iii) basidial shape, normally straight cylindrical in P. bandonii and typically curved (sigmoid) in S. tremelloidea; and (iv) shape of the components of zygoconidia, globose to subglobose in P. bandonii and narrowly obovoid in S. tremelloidea. The distinction of P. bandonii from T. papilionaceus is mainly based on (i) the shape of basidia, auricularioid in the former and Tremella-like in the latter; (ii) the mode of production of zygoconidia, which originate from two contiguous conidiogenic cells in P. bandonii and from two loci of the same conidiogenic cell in T. papilionaceus; (iii) the shape of each component of the zygoconidia, globose or subglobose in P. bandonii and cylindrical in T. papilionaceus; and (iv) the presence of thick-walled brownish hyphae in P. bandonii and only hyaline hyphae in T. papilionaceus. Due to the unavailability of cultures of S. tremelloidea, the nutritional profile of P. bandonii can only be compared with that of T. papilionaceus. Several carbon compounds (ribitol, xylitol, d-glucitol, galactitol and inositol) are assimilated by P. bandonii but not by T. papilionaceus. Moreover, the former produces amyloid compounds, which do not occur in the latter (Table II).
Among the hyphomycetes, the genera Papilionospora V. Rao & B. Sutton (Rao and Sutton 1975) and Anastomyces W. Wu, B. Sutton & Gange (Wu et al 1997) produce paired conidia. Their salient differences from Papiliotrema are absence of a distinct fruitbody, absence of clamp connections and haustoria, morphology of conidia and conidiogenous cells, and absence of a budding yeast stage.
Taxa with transversly septate (auricularioid) basidia have rarely been reported in the Tremellales. To date only three auricularioid taxa, Phragmoxenidium mycophilum Oberwinkler & Schneller, Phyllogloea tremelloidea Lowy, and Sigmogloea tremelloidea Bandoni & Krug are known in the Tremellales (Oberwinkler et al 1990, Oberwinkler 1993, Bandoni and Krug 2000). In this study we propose two new genera, Bulleribasidium and Papiliotrema, with this basidial type. However, it is possible that increasing knowledge of the biodiversity of the Tremellales, might reveal a widespread occurrence of this type of basidial morphology.
The genus Fibulobasidium Bandoni was described for dimorphic tremellaceous fungi, found beneath tree bark, probably associated with ascomycetes, having minute subcortical fruiting bodies with basidia singly or in clusters (Bandoni 1979). When in clusters, basidia are attached to one another laterally as a result of repeated clamp formation and subsequent enlargement of clamp loops. Up to now the genus included two species, viz. F. inconspicuum Bandoni, the type species, and F. sirobasidioides Bandoni, described more recently (Bandoni 1998). For morphological comparisons between F. murrhardtense and the other two species it should be taken into consideration that data on the new species are mainly derived from culture experiments, whereas the descriptions of the other species are based on material collected in the field. Fibulobasidium sirobasidioides produces the longest basidial chains having up to 12 basidia (Bandoni 1998). Such chains were not observed in the other two species (Bandoni 1979 and Figs. 11, 12). Irregularly coiled hyphae, sometimes giving a tortuous appearance to the bases of the basidial chains, are typical in F. murrhardtense, and constitute one of its most distinctive morphological traits. Dimensions of basidia and basidiospores of the three species cannot be used to differentiate them. Bandoni (1979, 1998) reported that the basidiospores of the two previously known species germinated by budding and repetition. We were unable to observe the latter process in F. murrhardtense. Morphologically, F. murrhardtense seems to be more similar to F. inconspicuum since the basidial chains are not as elongated as in F. sirobasidioides. However, the molecular phylogenetic hypothesis depicted in Fig. 36 indicates that F. murrhardtense is more closely related to F. sirobasidioides than to F. inconspicuum. In the D1/D2 region of the rDNA there are five different nucleotides between F. murrhardtense and F. inconspicuum and two different nucleotides between F. murrhardtense and F. sirobasidioides (three nucleotide differences can be observed between F. inconspicuum and F. sirobasidioides). Nevertheless, the concept of the genus, originally based on morphological criteria, is supported by molecular data. Whereas living cultures of F. inconspicuum and F. murrhardtense have been obtained, only herbarium material of F. sirobasidioides is available. For the latter species we were able to obtain a DNA sample that allowed us to proceed with sequence analysis. However, more detailed studies such as DNA–DNA reassociations between F. sirobasidioides and F. murrhardtense are presently unfeasible. Since living cultures of F. sirobasidioides are not available, the physiological comparisons depicted in Table II include only F. murrhardtense and F. inconspicuum. A number of 19 tests gave different responses for the two taxa, which indicates that nutritional data might be useful for the differentiation of species in the genus Fibulobasidium. Interestingly, the vast majority of the 19 discriminative tests gave negative results for F. murrhardtense. Bandoni (1979) reported a bifactorial mating system for F. inconspicuum. The original culture of F. murrhardtense was derived from multiple colonies growing on a Petri dish. This culture was able to develop the entire life cycle, but single colony isolates derived from it were not, thus indicating that F. murrhardtense is heterothallic. No further investigations concerning the mating system of the new species were carried out.
The Tremellales present nowadays a series of interesting taxonomic problems. Molecular analyses, such as the one shown in Fig. 36 and also those presented by Chen (1998) and Fell et al (2000), suggest that Tremella is polyphyletic and that several mitosporic taxa should not be neglected in future phylogenetic evaluations and classification proposals. Moreover, several teleomorphic species classified in this group have not yet been investigated by sequence analyses. The description and integrated characterization of new taxa seems essential to improve our knowledge of the major evolutionary events in the Tremellales and also for the development of more natural classification systems.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Accepted for publication May 4, 2002.
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
———. 1979 Fibulobasidium: a new genus in the Sirobasidiaceae. Can J Bot 57:264-268
———. 1998 On an undescribed species of Fibulobasidium. Can J Bot 76:1540-1543
———, Krug JC., 2000 Two undescribed heterobasidiomycetes from Ontario. Mycoscience 41:371-377
Boekhout T, Fonseca A, Batenburg–van der Vegte WH., 1991 Bulleromyces genus novum (Tremellales), a teleomorph for Bullera alba, and the occurrence of mating in Bullera variabilis. Antonie van Leeuwenhoek 59:81-93[Medline]
Chen C-J., 1998 Morphological and molecular studies in the genus Tremella. Bibl Mycol 174:1-225
———, Oberwinkler F, Chen Z-C., 1998 Syzygospora nivalis sp. nov. from Taiwan. Mycotaxon 67:217-226
Fell JW, Boekhout T, Fonseca A, Scorzetti G, Statzell-Tallman A., 2000 Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int J Syst Evol Microbiol 50:1351-1371[Abstract]
Felsenstein J., 1981 Evolutionary trees from DNA sequences: a maximum likelihood approach. J Mol Evol 17:368-376[Medline]
———. 1985 Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783-791
Fitch WM., 1971 Toward defining the course of evolution: minimum change for a specific tree topology. Syst Zool 20:406-416
Kidd KK, Sgaramella–Zonta LA., 1971 Phylogenetic analysis: concepts and methods. Am J Human Genet 23:235-252[Medline]
Kirschner R, Oberwinkler F., 2001 A new species of Colacogloea with zygoconidia. Sydowia 52:195-203
Kurtzman CP, Smiley MJ, Johnson CJ, Wickerham LJ, Fuson GB., 1980 Two closely related heterothallic species, Pichia amylophila and Pichia mississipiensis: characterization by hybridization and deoxyribonucleic acid reassociation. Int J Syst Bacteriol 30:208-216
Marmur J, Doty P., 1962 Determination of the base composition of DNA from its thermal denaturation temperature. J Mol Biol 5:109-118[Medline]
Oberwinkler F., 1993 Diversity and phylogenetic importance of tropical heterobasidiomycetes. In: Isaac S, Frankland JC, Watling R, Whalley AJS, eds. Aspects of tropical mycology. Cambridge Univ Press. p 121–147
———, Bandoni R., 1982 Carcinomycetaceae: a new family in the Heterobasidiomycetes. Nordic Journal of Botany 2:501-516
———, ———. 1983 Trimorphomyces: a new genus in the Tremellaceae. System Appl Microbiol 4:105-113
———, ———, Bauer R, Deml G, Kisimova–Horovitz L., 1984 The life-history of Christiansenia pallida, a dimorphic, mycoparasitic heterobasidiomycete. Mycologia 76:9-22
———, Bauer R, Schneller J., 1990 Phragmoxenidium mycophilum sp. nov., an unusual mycoparasitic heterobasidiomycete. System Appl Microbiol 13:186-191
Posada D, Crandall KA., 1998 Modeltest: testing the model of DNA substitution. Bioinformatics 14:817-818
Reynolds ES., 1963 The use of lead citrate at high pH as an electron opaque stain in electron microscopy. J Cell Biol 17:208-212
Rambaut A., 1996 Se-Al. Sequence Alignment Editor. Department of Zoology, University of Oxford. Oxford, U.K
Rao V, Sutton BC., 1975 Synnematous fungi. I. Kavaka 3:21-26
Roberts P., 1994 Zygogloea gemellipara: an auricularioid parasite of Myxarium nucleatum. Mycotaxon 52:241-246
Sampaio JP, Gadanho M, Bauer R., 2001 Taxonomic studies on the genus Cystofilobasidium: description of Cystofilobasidium ferigula sp. nov. and clarification of the status of Cystofilobasidium lari–marini. Int J Syst Evol Microbiol 51:221-229[Abstract]
Spurr AR., 1969 A low-viscosity epoxy resin embedding medium for electron microscopy. J Ultrastruct Res 26:31-43[Medline]
Swofford DL, Olsen GJ, Waddell PJ, Hillis DM., 1996 Phylogenetic Inference. In: Hillis DM, Moritz C, Mable BK, eds. Molecular systematics. Massachusetts: Sinauer Associates, Inc. p 407–514
———. 2000 PAUP*. Phylogenetic analysis using parsimony (*and other methods):. Sunderland, Massachusetts: Sinauer Associates
Tamura K, Nei M., 1993 Estimation of the number of nucleotide substitution in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10:512-526[Abstract]
Weiß M, Oberwinkler F., 2001 Phylogenetic relationships in Auriculariales and related groups—hypotheses derived from nuclear ribosomal DNA sequences. Mycol Res 105:403-415
Wu W, Sutton BC, Gange AC., 1997 Notes on three fungicolous fungi: Anastomyces microsporus gen. et sp. nov., Idriella rhododendri sp. nov. and Infundibura adhaerens. Mycol Res 11:1318-1322
Yarrow D., 1998 Methods for the isolation, maintenance and identification of yeasts. In: Kurtzman CP, Fell JW, eds. The yeasts, a taxonomic study. 4th ed. Amsterdam: Elsevier. p 77–100
This article has been cited by other articles:
 |
|
 |
|
  C. H. Pohl, J. L. F. Kock, P. W. J. van Wyk, and J. Albertyn Cryptococcus anemochoreius sp. nov., a novel anamorphic basidiomycetous yeast isolated from the atmosphere in central South Africa. Int J Syst Evol Microbiol, November 1, 2006; 56(Pt 11): 2703 - 2706. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. Sampaio, J. Inacio, A. Fonseca, M. Gadanho, I. Spencer-Martins, G. Scorzetti, and J. W. Fell Auriculibuller fuscus gen. nov., sp. nov. and Bullera japonica sp. nov., novel taxa in the Tremellales Int J Syst Evol Microbiol, May 1, 2004; 54(3): 987 - 993. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Garnica, M. Weiss, B. Oertel, and F. Oberwinkler Phylogenetic relationships of European Phlegmacium species (Cortinarius, Agaricales) Mycologia, November 1, 2003; 95(6): 1155 - 1170. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. I. Golubev, M. Gadanho, J. P. Sampaio, and N. W. Golubev Cryptococcus nemorosus sp. nov. and Cryptococcus perniciosus sp. nov., related to Papiliotrema Sampaio et al. (Tremellales) Int J Syst Evol Microbiol, May 1, 2003; 53(3): 905 - 911. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
