Mycologia
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cruse, M.
Right arrow Articles by Taylor, J. W.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Cruse, M.
Right arrow Articles by Taylor, J. W.
Agricola
Right arrow Articles by Cruse, M.
Right arrow Articles by Taylor, J. W.
Mycologia, 94(5), 2002, pp. 814-822.
© 2002 by The Mycological Society of America

Cryptic species in Stachybotrys chartarum


Michael Cruse
Robin Telerant
Thomas Gallagher
Thomas Lee
John W. Taylor 1

     Department of Plant and Microbial Biology, 321 Koshland Hall, University of California, Berkeley, California, USA 94720-3102

    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 

Stachybotrys chartarum has received much attention as a possible cause of sick-building syndrome. Because morphological species recognition in fungi can hide diversity, we applied a phylogenetic approach to search for cryptic species. We examined 23 isolates from the San Francisco Bay Area, and another seven from around the US. Using markers we developed for three polymorphic protein coding loci (chitin synthase 1, beta-tubulin 2, and trichodiene synthase 5), we infer that two distinct phylogenetic species exist within the single described morphological species. We have found no correlation between genetic isolation and geographic distance.

Key words: fungal species, molecular evolution, phylogenetic species, population genetics, sick-building syndrome


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Stachybotrys chartarum is a toxigenic fungus of worldwide distribution. It is of particular interest because it is implicated as a cause of "sick building syndrome" (Cooley et al 1998Citation). This fungus can grow on the paper covering gypsum wallboard, provided that it is saturated by water, and introduce potentially toxic spores into buildings. It produces numerous toxins, including a set of highly toxic trichothecenes (Jarvis et al 1998Citation). These toxins can cause stachybotrytoxicosis, which first was described in Russia in 1931 when thousands of horses died from consuming contaminated hay (Forgas 1972Citation). The fungus has been shown to produce the hemolysin stachylysin (Vesper et al 2001Citation), and has been suspected as a cause of infant pulmonary hemosiderosis (Anonymous 1994Citation), although this association is controversial (Anonymous 2000Citation).

Stachybotrys chartarum is one of 11 morphologically recognized Stachybotrys species (Jong and Davis 1976Citation). Their phylogenetic relationships have been established by analysis of the rDNA internal transcribed spacer (ITS) (Haugland et al 2001Citation), which suggested that two Memnoniella species be transferred to Stachybotrys, bringing to 13 the total number of morphologically recognized Stachybotrys species.

We wondered if more than one phylogenetic species could be recognized in the morphological species, S. chartarum. This possibility was suggested by variation among individuals seen in the RAPD analysis conducted by Vesper and colleagues (Vesper et al 1999Citation, 2000Citation), by other work showing variation in the levels of toxin production among S. chartarum individuals (Jarvis 1998Citation, Vesper et al 1999Citation), and by the discovery of one biallelic, polymorphic nucleotide position within the ITS region of Stachybotrys chartarum (Haugland et al 2001Citation). To recognize phylogenetic species, one gene genealogy cannot suffice (Taylor et al 2000Citation), therefore we used the concordance of three gene genealogies to search for phylogenetic species in Stachybotrys chartarum.

Phylogenetic species have been recognized in other morphological fungal species, such as, Coccidioides immitis (Koufopanou et al 1997Citation), Histoplasma capsulatum (Kasuga et al 1999Citation), Aspergillus flavus (Geiser et al 1998Citation) and the Letharia vulpinaLetharia columbiana complex (Kroken and Taylor 2001Citation). Biological species recognition was possible only in Histoplasma capsulatum (teleomorph Ajellomyces capsulatus), because the others, like S. chartarum, either are asexual or cannot be mated experimentally.

To determine phylogenetic species boundaries in S. chartarum, gene genealogies were constructed by sequencing regions from three independent genes in 30 individuals of S. chartarum, 23 of which were from the San Francisco Bay Area of California and seven from other regions of the United States. Maximum parsimony analysis of the variation present in the genes, separately and together, partitioned the isolates into two strongly supported phylogenetic species, which lack any obvious geographic correlation.


    MATERIAL AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Fungal isolates – Putative isolates of S. chartarum were obtained from structures and leaf litter in Northern California. Isolates from other parts of the United States were purchased from a commercial lab specializing in the identification of fungi growing in structures. Putative samples of Stachybotrys chartarum were collected from structures by using clear adhesive tape to remove fungi from the contaminated region and affixing the tape to a glass slide in the field. Pieces of tape were cut from the slide and placed on wet sterile Whatman #1 filter paper sitting atop sterile 1% H2O agar plates (Difco, Detroit, Michigan). Putative environmental samples of S. chartarum were obtained by macerating potentially contaminated leaf litter with sterile water in a Waring blender. The resulting homogenate was poured on sterile Whatman #1 filter paper sitting atop 1% H2O agar plates. Isolates from around the United States were purchased from Pathcon Laboratories (Norcross, Georgia). Sample location and number are shown in Table I.


View this table:
[in this window]
[in a new window]
 
TABLE I. Sample sheet

 
Putative S. chartarum colonies grown on filter paper from tape or leaf samples were transferred to sterile Whatman #1 filter paper sitting atop 1% H2O water agar plates and maintained on the filter papers or subsequently transferred to cornmeal agar plates (Difco, Detroit, Michigan). The identities of the samples were initially checked by observing morphology as described by Jong and Davis (Jong and Davis 1976Citation). For long-term storage, mycelium was grown in 5 mL of yeast extract broth (20 g glucose, 10 g yeast extract, 2 g peptone per 1 liter water) for 2–3 d and lyophilized. Mycelium for DNA extraction was obtained in a similar manner. Mycelium was grown in 100 mL of yeast broth at room temperature for 3–4 d with agitation. Mycelium was collected by filtration, frozen in liquid nitrogen, and lyophilized.

DNA extraction, amplification, and sequencing – DNA was extracted using a modification of a CTAB extraction protocol (Platt 1999Citation). Approximately 200 mg of lyophilized sample was placed in a 2 mL bead beater tube along with 2–3, 5 mm glass beads and 1 mL of 2x CTAB extraction buffer (Doyle and Doyle 1987Citation). The tube was agitated for ca 30 s on a Beadbeater (Bartlesville, Oklahoma) at maximum speed. Following lysis, the samples were extracted with 750 µL of chloroform : isoamyl alcohol (24:1). The DNA was purified further using Qiagen's DNeasy kit (Cat. No. 69506, Qiagen, Valencia, California) following manufacturer's instructions.

As a second check of identity, amplicons for the ribosomal internal transcribed spacer (ITS) were sequenced as described below using the ITS primer pair ITS1/4 (White et al 1990Citation) or ITS1A/4F (Gardes and Bruns 1993Citation) from a subset of the samples (1, 2, 4, 17, 101, 102, 103, 105, 108, 109). The sequences of these PCR-amplified fragments were compared to GenBank sequences (AF081468 and AF206273) using Sequence Navigator 1.01 (Applied Biosystems, Foster City, California).

Three loci were sequenced, as described below, in order to recognize phylogenetic species by the concordance of gene genealogies. The trichodiene synthase 5 fragment (tri5) was obtained by designing primers for the published sequence of trichodiene synthase 5 (GenBank AF053926) using Oligo 4.0 (National Biosciences Inc., Plymouth, Minnesota). The 5' primer used was CATCAATCCAACAGTTTCAC and the 3' primer GCAACCTTCAAAGACTATTG. The beta-tubulin 2 (tub2) primers were designed by aligning sequences of tub2 for closely related ascomycetes (Gibberella fujikuroi Genbank U27303, Aspergillus flavus Genbank M38265, Neurospora crassa Genbank M13630, Colletotricum gloeosporioides Genbank U14138, and Acremonium chrysogenum Genbank X72789). A consensus sequence was made and a degenerate primer pair was designed by hand and then checked in Oligo. The tub2 used was CTGTCCAACCCCTCTTACGGCGACCTGAAC for the 5' primer and ACCCTCACCAGTATACCAATGCAAGAAAGC for the 3' primer. The chitin synthase 1 fragment (chs1) was obtained using the degenerate chitin synthase primer set MYK1/2 (Bowen et al 1992Citation). Sequence from this PCR amplification was used as the basis for designing taxon specific primers. The taxon specific primers were ATCTCACCACAAGCACCGCCACACA for the 5' primer and GGAAGAAGATCGTTGTGTGCGTGGT for the 3' primer.

Tri5 and tub2 of the Stachybotrys chartarum genome were amplified from DNA samples using 50-µL polymerase chain reactions (PCR) containing 0.5 units of AmpliTaq DNA polymerase, 10 mM Tris/HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.1 mg/mL gelatin, and 200 µM of each of four deoxyribonucleotide triphospates. Primers were added in 0.5 µM concentrations in tub2, tri5, and ITS. Chs1 was amplified in 20 µL reactions with a primer concentration of 1 µM.

PCR products were prepared for sequencing using Qiagen's QIAquick PCR purification kit or using an isopropanol precipitation (Platt and Spatafora 1999Citation). All chs1 products were cleaned using an isopropanol precipitation. Purified PCR product was sequenced using an ABI model 377 Sequencer and ABI PRISM BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Foster City, California). We analyzed and aligned the obtained sequences using Sequencing Analysis 3.0 and Sequence Navigator 1.01 (Applied Biosystems, Foster City, California). The initial sequences obtained from the loci were tested for identity by using a nucleotide-nucleotide BLAST search (Altschul et al 1997Citation) with a low complexity filter and word size set to 11. A translated BLAST search (Altschul et al 1997Citation) was then performed with a low complexity filter and a word size set to 3 on the sequences obtained for tub2 and chs1 to approximate intron and exon sites.

Phylogenetic analysis – Sequences obtained from tri5, tub2, and chs1 were aligned and then checked by eye using Sequence Navigator 1.01 (Applied Biosystems, Foster City, California). There were no gaps in the alignments. The aligned sequences were exported to a NEXUS file and analyzed using PAUP 4.0b8 (Swofford 2001Citation). ITS sequence data was used only for identification and it was not included in the phylogenetic analysis.

All sequences were placed in a single NEXUS file and partitioned by each locus to create the complete data set. These data were then analyzed using maximum parsimony. Due to low amounts of variation and virtually no homoplasy in the data set, unless otherwise stated all parameters were set to the default suggested by PAUP, in which gaps were treated as missing data, multiple states were treated as uncertainties, character states were optimized using the accelerated transformation algorithm, and zero length branches were collapsed. Analysis was done individually on each locus and on all loci combined. Heuristic searches were carried out using tree-bisection reconnection and 1000 random sequence additions. The set of the most parsimonious trees was compared using maximum likelihood by the Kishino-Hasegawa test (Kishino and Hasegawa 1989Citation) as implemented in PAUP. Algorithm-specific biases were tested for by comparing parsimony trees to trees created using neighbor-joining and maximum likelihood. Support for internal branches was assessed using a heuristic parsimony search of 1000 bootstrapped data sets. To assess congruence among trees produced by the different loci, the partition-homogeneity test was conducted in PAUP using only the parsimony informative characters. The likelihoods of the trees shown were not significantly different from those of the other equally parsimonious trees, as determined by the Kishino-Hasegawa test. The trees shown are rooted at the midpoint.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
The full data matrix and the trees used in the analysis are available from TreeBASE, study accession number S724, matrix accession number M1155. The ITS sequences of the putative S. chartarum individuals all matched one of the two expected sequences of S. chartarum (Haugland and Heckman 1998Citation), which differ at only one polymorphic nucleotide position.

A translated BLAST search indicated that chs1 sequences obtained were all protein coding. A sample from each clade was chosen for submission to Genbank (sample 5 AF468158 and sample 6 AF468159). The alignments are available on TreeBASE. Maximum parsimony analysis of chs1 produced one tree shown in Fig. 1. This tree has a consistency index (CI) of 1, retention index (RI) of 1, and a homoplasy index (HI) of 0. There are 11 informative, and two variable, uninformative characters in this data set.



View larger version (24K):
[in this window]
[in a new window]
 
 FIG. 1. Chitin synthase gene genealogy. The single most parsimonious tree based on chs1 gene sequence using a heuristic search with 1000 random sequence additions as described in the text. Support for internal branches represents the percentage of 1000 bootstrap resampled data sets containing the branch. A scale for the number of nucleotide substitutions is given

 
The sequences obtained for tub2 have a 63 bp putative intron, according to data obtained from a translated BLAST search, and character changes are not present in the intron at a higher frequency than in the exons. A sample from each clade was chosen for submission to Genbank (sample 5 AF468156 and sample 6 AF468157). Maximum parsimony analysis of tub2 produced eight trees. The occurrence of multiple trees is due to unsequenced characters in the sequence of isolate 14. All eight trees have a CI of 1, and RI of 1 and a HI of 0. The tree shown in Fig. 2 has the highest log-likelihood of the eight most parsimonious trees as determined by the Kishino-Hasegawa test, though there is no significant difference among the eight likelihood scores. There are 27 informative and two variable, uninformative characters in this set.



View larger version (24K):
[in this window]
[in a new window]
 
 FIG. 2. Beta-tubulin gene genealogy. Shown is the one of eight most parsimonious trees based on tub2 gene sequence using a heuristic search with 1000 random sequence additions as described in the text, for which the data set is the most likely based on maximum likelihood analysis. Support for internal branches represents the percentage of 1000 bootstrap resampled data sets containing the branch. A scale for the number of nucleotide substitutions is given

 
Maximum parsimony analysis of tri5 produced a single tree shown in Fig. 3. A sample from each clade was chosen for submission to Genbank (sample 5 AF468154 and sample 6 AF468155). This tree has a CI of 1, RI of 1, and HI of 0. There are 30 parsimony-informative characters and one variable, uninformative character.



View larger version (24K):
[in this window]
[in a new window]
 
 FIG. 3. Trichodiene synthase 5 gene genealogy. The single most parsimonious tree based on tri 5 gene sequence using a heuristic search with 1000 random sequence additions as described in the text. Support for internal branches represents the percentage of 1000 bootstrap resampled data sets containing the branch. A scale for the number of nucleotide substitutions is given

 
Phylogenetic analysis of the complete data set with the three genes made use of 1350 characters for 30 taxa. Of these characters, 68 were potentially parsimony-informative, and five were potentially uninformative. The initial heuristic search produced three equally parsimonious trees each having a consistency index of 1, a retention index of 1, and a homoplasy index of 0. All three trees were part of one island. All three trees showed two distinct clades separated from one another by one branch supported by 65 characters, which was found in of 100% of bootstrapped data sets. The tree shown in Fig. 4 has the highest log-likelihood of the three most parsimonious trees. There is no significant difference in the likelihood scores among the trees. Trees created using neighbor-joining algorithms had the same topology as those created with maximum parsimony.



View larger version (25K):
[in this window]
[in a new window]
 
 FIG. 4. Combined chs1, tub2 and tri5 phylogeny. Shown is the one of three most parsimonious trees based on combined gene sequence using a heuristic search with 1000 random sequence additions as described in the text, for which the data set is the most likely based on maximum likelihood analysis. Support for internal branches represents the percentage of 1000 bootstrap resampled data sets containing the branch. A scale for the number of nucleotide substitutions is given.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
The trees produced from our data set show that the single morphological species S. chartarum actually is composed of two phylogenetic species. The large percentage (approximately 5%) of nucleotide positions in the three protein-coding loci that are fixed for alternate nucleotides between the two species is consistent with a long period of genetic isolation. Of 73 variable characters, 63 were fixed between the species while three were confirmed variable within one species but not the other. Unsequenced characters could potentially make this number as high as ten. For comparison, in the two phylogenetic species of Cocciodies immitis only half of the variable nucleotide positions are fixed in both species; the other half are fixed in one and variable in the other (Koufopanou et al 1997Citation). This result might seem contradictory to previous RAPD analysis by Vesper and colleagues (Vesper et al 1999Citation, 2000Citation), which did not show strongly supported branches in analyses of all isolates. This apparent conflict may be explained in two ways: the sampling of Vesper and colleagues did not include members of the one of the clades found here, or RAPD analysis was not be able to elucidate the two species (Taylor et al 1999Citation).

Though the period since the divergence of the two phylogenetic species may have been long, the genetic isolation does not correlate with the geographic isolation. In this study the diversity seen in a single room was similar to the diversity seen throughout the US. This pattern of variation is similar to that seen in Aspergillus flavus (Geiser et al 1998Citation, Tran-Dinh et al 1999Citation) and Neurospora species (Spieth 1975Citation), but is unlike the strong geographic distinction seen between the phylogenetic species in Histoplasma capsulatum (Kasuga et al 1999Citation) and Coccidioides immitis (Koufopanou et al 1997Citation, 1998Citation, Fisher et al 2001Citation). With further geographic sampling it will be possible to see if this lack of correlation is an effect of our limited sampling, or perhaps, of the spread of this fungus by human activity. With further sampling and markers it may also be possible to identify populations within the species, as has been done for C. immitis (Fisher et al 2001Citation).

Each clade is fixed for one of the two alleles for ITS as previously described (Haugland and Heckman 1998Citation). One clade (the larger group) has the ITS sequence of the type collection (ATCC 9182, GenBank AF081468). The other clade, therefore, represents the new phylogenetic species.

Due to the recent attention given to S. chartarum, a pressing question is raised by this study. Are the types and amounts of toxin produced by members of the two phylogenetic species different? We hope that our work will stimulate research in this area.


    ACKNOWLEDGMENTS
 
We thank Brian Shelton of PathCon Laboratories, Norcross, Georgia for providing isolates of S. chartarum obtained from throughout the US, and Scott Kroken, Jamie Platt, and Martin Bidartondo for providing guidance throughout the project.

The work was supported by Torrey Mesa Research Institute, the Miller Institute for Basic Research in Science, and NIH-NIAID.


    FOOTNOTES
 
1 Corresponding author: Email: jtaylor{at}socrates.berkeley.edu Back

Accepted for publication February 25, 2002.


    LITERATURE CITED
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ., 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389-3402[Abstract/Free Full Text]

Bowen AR, Chen-Wu JL, Momany M, Young R, Szaniszlo PJ, Robbins PW., 1992 Classification of fungal chitin synthases. Proc Natl Acad Sci USA 89:519-523[Abstract/Free Full Text]

Anonymous. 1994 Acute pulmonary hemorrhage/hemosiderosis among infants-Cleveland, January 1993–November 1994. MMWR 43:881-883[Medline]

———. 2000 Update: pulmonary hemorrhage/hemosiderosis among infants—Cleveland, Ohio, 1993–1996. MMWR 49:180-184[Medline]

Cooley JD, Wong WC, Jumper CA, Straus DC., 1998 Correlation between the prevalence of certain fungi and sick building syndrome. Occup Environ Med 55:579-584[Abstract/Free Full Text]

Doyle JJ, Doyle JL., 1987 A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11-15

Fisher MC, Koenig GL, White TJ, San-Blas G, Negroni R, Alvarez IG, Wanke B, Taylor JW., 2001 Biogeographic range expansion into South America by Coccidioides immitis mirrors New World patterns of human migration. Proc Nat Acad Sci USA 98:4558-4562[Abstract/Free Full Text]

Forgas J., 1972 Stachybotryotoxicosis. Microbial Toxins 8:95-128

Gardes M, Bruns TD., 1993 ITS primers with enhanced specificity for basidiomycetes—application to the identification of mycorrhizae and rusts. Mol Eco 2:113-118

Geiser DM, Pitt JI, Taylor JW., 1998 Cryptic speciation and recombination in the aflatoxin-producing fungus Aspergillus flavus. Proc Natl Acad Sci USA 95:388-393[Abstract/Free Full Text]

Haugland RA, Heckman JL., 1998 Identification of putative sequence specific PCR primers for detection of the toxigenic fungal species Stachybotrys chartarum. Mol Cell Probes 12:387-396[Medline]

———, ———, Vesper SJ, Harmon SM., 2001 Phylogenetic relationships of Memnoniella and Stachybotrys species and evaluation of morphological features for Memnoniella species identification. Mycologia 93:54-65

Jarvis BB, Sorenson WG, Hintikka E-L, Nikulin M, Zhou Y, Jiang J, Wang S, Hinkley S, Etzel RA, Dearborn D., 1998 Study of toxin production by isolates of Stachybotrys chartarum and Memnoniella echinata isolated during a study of pulmonary hemosiderosis in infants. Appl and Environ Microbiol 64:3620-3625

Jong SC, Davis EE., 1976 Contribution to the Knowledge of Stachybotrys and Memnoniella in Culture. Mycotaxon 3:409-485

Kasuga T, Taylor JW, White TJ., 1999 Phylogenetic relationships of varieties and geographical groups of the human pathogenic fungus Histoplasma capsulatum darling. Clin Microbiol 37:653-663

Kishino H, Hasegawa M., 1989 Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order of the Hominoidea. J Mol Evol 29:170-179[Medline]

Koufopanou V, Burt A, Taylor JW., 1997 Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccidioides immitis. Proc Natl Acad Sci USA 94:5478-5482[Abstract/Free Full Text]

———, ———. 1998 Correction: concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccidioides immitis. Proc Natl Acad Sci USA 95:8414-8414[Free Full Text]

Kroken S, Taylor JW., 2001 A gene genealogical approach to recognize phylogenetic species boundaries in the lichenized fungus Letharia. Mycologia V93: (N1) 38-53

Platt JL., 1999 Phylogenic reconstruction of the Earth Tongues (Geoglossaceae, Helotiales) inferred from nuclear ribosomal DNA. Corvallis: Oregon State University. p 109–111

———, ———, Spatafora JW., 1999 A re-examination of generic concepts of baeomycetoid lichens based on phylogenetic analyses of nuclear SSU and LSU ribosomal DNA. Lichenologist 31:409-418

Spieth PT., 1975 Population genetics of allozyme variation in Neurospora intermedia. Genetics 80:785-805[Abstract/Free Full Text]

Swofford DL., 2001 PAUP*. Phylogenetic analysis using parsimony (*and other methods). Version 4.0b8. Sunderland, Massachusetts: Sinauer Associates

Taylor JW, Geiser DM, Burt A, Koufopanou V., 1999 The evolutionary biology and population genetics underlying fungal strain typing. Clin Microbiol Rev 12:126-146[Abstract/Free Full Text]

———, ———, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, Fisher MC., 2000 Phylogenetic species recognition and species concepts in fungi. Fungal Genet Biol 31:21-32[Medline]

Tran-Dinh N, Pitt JI, Carter DA., 1999 Molecular genotype analysis of natural toxigenic and nontoxigenic isolates of Aspergillus flavus and A. parasiticus. Mycol Res V103: (PT11) 1485-1490

Vesper SJ, Dearborn DG, Elidemir O, Haugland RA., 2000 Quantification of siderophore and hemolysin from Stachybotrys chartarum strains, including a strain isolated from the lung of a child with pulmonary hemorrhage and hemosiderosis. Appl Environ Microbiol 66:2678-2681[Abstract/Free Full Text]

Vesper SJ, Dearborn DG, Yike I, Sorenson WG, Haugland RA., 1999 Hemolysis, toxicity, and randomly amplified polymorphic DNA analysis of Stachybotrys chartarum strains. Appl Environ Microbiol 65:3175-3181[Abstract/Free Full Text]

Vesper SJ, Magnuson ML, Dearborn DG, Yike I, Haugland RA., 2001 Initial characterization of the hemolysin stachylysin from Stachybotrys chartarum. Infect Immun 69:912-916[Abstract/Free Full Text]

White TJ, Bruns T, Lee S, Taylor J., 1990 Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego: Academic Press. p 315–322




This article has been cited by other articles:


Home page
J. Clin. Microbiol.Home page
M. Azor, J. Gene, J. Cano, P. Manikandan, N. Venkatapathy, and J. Guarro
Less-Frequent Fusarium Species of Clinical Interest: Correlation between Morphological and Molecular Identification and Antifungal Susceptibility
J. Clin. Microbiol., May 1, 2009; 47(5): 1463 - 1468.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
M. Azor, J. Gene, J. Cano, D. A. Sutton, A. W. Fothergill, M. G. Rinaldi, and J. Guarro
In Vitro Antifungal Susceptibility and Molecular Characterization of Clinical Isolates of Fusarium verticillioides (F. moniliforme) and Fusarium thapsinum
Antimicrob. Agents Chemother., June 1, 2008; 52(6): 2228 - 2231.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
M. D. Lindsley, J. Guarro, R. N. Khairy, J. Williams, N. Iqbal, and P. Pancholi
Pseudallescheria fusoidea, a New Cause of Osteomyelitis
J. Clin. Microbiol., June 1, 2008; 46(6): 2141 - 2143.
[Abstract] [Full Text] [PDF]


Home page
MycologiaHome page
G. W. Douhan, K. L. Huryn, and L. I. Douhan
Significant diversity and potential problems associated with inferring population structure within the Cenococcum geophilum species complex.
Mycologia, November 1, 2007; 99(6): 812 - 819.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
M. Azor, J. Gene, J. Cano, and J. Guarro
Universal In Vitro Antifungal Resistance of Genetic Clades of the Fusarium solani Species Complex
Antimicrob. Agents Chemother., April 1, 2007; 51(4): 1500 - 1503.
[Abstract] [Full Text] [PDF]


Home page
MycologiaHome page
Q.-M. Zhou, S.-Y. Guo, M.-R. Huang, and J.-C. Wei
A study of the genetic variability of Rhizoplaca chrysoleuca using DNA sequences and secondary metabolic substances.
Mycologia, January 1, 2006; 98(1): 57 - 67.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
F. Gilgado, J. Cano, J. Gene, and J. Guarro
Molecular Phylogeny of the Pseudallescheria boydii Species Complex: Proposal of Two New Species
J. Clin. Microbiol., October 1, 2005; 43(10): 4930 - 4942.
[Abstract] [Full Text] [PDF]


Home page
Indoor and Built EnvironmentHome page
J. Singh
Toxic Moulds and Indoor Air Quality
Indoor and Built Environment, June 1, 2005; 14(3-4): 229 - 234.
[Abstract] [PDF]


Home page
MycologiaHome page
M. C. Molina, P. T. DePriest, and J. D. Lawrey
Genetic variation in the widespread lichenicolous fungus Marchandiomyces corallinus
Mycologia, March 1, 2005; 97(2): 454 - 463.
[Abstract] [Full Text] [PDF]


Home page
MycologiaHome page
B. Andersen, K. F. Nielsen, U. Thrane, T. Szaro, J. W. Taylor, and B. B. Jarvis
Molecular and phenotypic descriptions of Stachybotrys chlorohalonata sp. nov. and two chemotypes of Stachybotrys chartarum found in water-damaged buildings
Mycologia, November 1, 2003; 95(6): 1227 - 1238.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cruse, M.
Right arrow Articles by Taylor, J. W.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Cruse, M.
Right arrow Articles by Taylor, J. W.
Agricola
Right arrow Articles by Cruse, M.
Right arrow Articles by Taylor, J. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS