| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Plant Pathology, Cornell University, Ithaca, New York 14853
William E. Fry 1
Former DuPont Fellow at Cornell University
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Two extant nomenclature systems were reconciled to relate six mitochondrial DNA (mtDNA) haplotypes of Phytophthora infestans, the oomycete pathogen causing late blight disease on potato and tomato. Carter's haplotypes I-a and I-b were included in Goodwin's haplotype A, while Carter's haplotypes II-a and II-b were included in Goodwin's haplotype B. In addition, haplotypes E and F were included in Carter's haplotype I-b. The mutational differences separating the various haplotypes were determined, and we propose that either haplotype I-b(A) or haplotype I-a(A) is the putative ancestral mtDNA of P. infestans, because either can center all the other haplotypes in a logical stepwise network of mutational changes. The occurrence of the six haplotypes in 548 isolates worldwide was determined. Haplotypes I-a and II-a were associated with diverse genotypes worldwide. As previously suggested, haplotype I-b was found only in the US-1 clonal lineage and its variants (n = 99 isolates from 16 countries on 5 continents), and haplotype II-b was limited to the US-6 clonal lineage and its derivatives (n = 36). In a confirmation of a previous suggestion, the randomly mating population in the Toluca Valley of central Mexico (n = 78) was monomorphic for mtDNA haplotype I-a(A). We hypothesize that selection there may be driving the dominance of that single mtDNA haplotype.
Key words: mtDNA haplotypes, oomycete, population genetics
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). The P. infestans mtDNA is A + T-rich (76%) and is predominantly composed of coding sequence (Paquin et al 1997). Chesnick and colleagues (1996) analyzed the sequence of the mitochondrial nad 4L gene and affirmed that the oomycete Phytophthora is more closely related to the chromophytic algae Chrysodisymus synuroides and Ochromonas danica (both groups are placed in the Kingdom Stramenopila) than to filamentous fungi. In addition, stramenopile mtDNAs have low variability in genome size and gene complement (Chesnick et al 2000).
An initial report of limited mitochondrial diversity in P. infestans (Klimczack and Prell 1984) has been confirmed several times via two systems of nomenclature. Carter et al (1990) used RFLP analysis to describe four mtDNA haplotypes (I-a, I-b, II-a, and II-b) among 24 isolates from 11 countries. In a subsequent study, Griffith and Shaw (1998) used mtDNA sequence information (Paquin et al 1997) to devise a polymerase chain reaction (PCR)-RFLP method to detect Carter's four haplotypes among 90 isolates (with the majority from Russia (n = 57) and the United Kingdom (n = 16)). At nearly the same time as Carter's work, Goodwin (1991) described by Southern analysis four haplotypes (A, B, C, and D) among 173 isolates, mainly from Mexico (n = 86), Peru (n = 15), and Europe (n = 36). In addition, Koh et al (1994) found two other haplotypes (E and F) using Goodwin's method to assay 124 isolates from east Asian countries. Although many isolates have been tested for mtDNA diversity, two unrelated methods with two autonomous nomenclatures have been used on different isolates from various locations—creating some confusion about generalities from these studies.
In general, the two nomenclature systems exhibit common themes. Carter's haplotype groups I and II seem to correspond to Goodwin's haplotypes A and B, respectively (Carter et al 1991, Goodwin 1991). This means that Goodwin's haplotype A includes both of Carter's haplotypes I-a and I-b; and Goodwin's haplotype B includes both of Carter's haplotypes II-a and II-b. However, it is not yet explicitly clear how Goodwin's haplotypes C and D, and Koh's haplotypes E and F, relate to Carter's haplotypes.
The identification of mutational changes in mtDNAs may provide insights into their relationships. In P. infestans, Carter et al (1990) concluded that the group II haplotype arose by an insertion of a 2 Kb fragment into group I. This suggests that the ancestral mtDNA does not have the 2 Kb insert. On the other hand, Goodwin (1991) observed that haplotype C differed from haplotype A by an insertion, and haplotype D might have undergone several mutations. Koh et al (1994) inferred that haplotype E had a deletion whereas haplotype F had an insertion when compared to haplotype A. These comparisons point to the possibility that haplotype A (group I) may be the ancestral mtDNA from which other haplotypes were generated through mutations. Additional markers may reveal other associations among the diverse mtDNA haplotypes.
An investigation of isolates from the probable center of origin of P. infestans in central Mexico may unravel clues on the evolution of its mitochondrial genome. One would expect to find diverse haplotypes, and perhaps the ancestral mtDNA, in the Toluca Valley of central Mexico where the P. infestans population has the greatest diversity in nDNA (Goodwin et al 1992b, Goodwin 1997). Goodwin and co-workers (Goodwin 1991, Goodwin et al 1992b) had sampled the populations of P. infestans in different parts of Mexico. Interestingly, they found only two haplotypes, A and D, among 33 diverse (nDNA) isolates from central Mexico (Goodwin 1991, Goodwin et al 1992b). Haplotype B was absent from central Mexico, yet it was more common than haplotype A among 64 isolates from northern Mexico (Goodwin 1991).
Knowledge of mitochondrial haplotypes has led to some interesting observations concerning populations of P. infestans. First, some haplotypes seem to have limited geographical distribution. For example, haplotypes I-a and II-a have been associated with the populations introduced into Europe during the 1970s (Carter et al 1991, Day and Shattock 1997, Griffith and Shaw 1998). Haplotype II-b has been limited to North America (Carter et al 1991, Griffith and Shaw 1998). Additionally, certain mtDNA haplotypes have been associated with particular nDNA genotypes. Haplotype I-b has been associated with the US-1 clonal lineage (Griffith and Shaw 1998). It is hypothesized that the US-1 lineage survived an extreme genetic bottleneck during its initial migration from Mexico into the United States and the rest of the world (Fry et al 1993, Goodwin et al 1994). Haplotypes E and F were found only among variants of the US-1 genotype in the Philippines (Koh et al 1994). These haplotypes may be closely related to haplotype I-a or I-b. Finally, the II-b or B haplotype was initially found only in the US-6 clonal lineage (Gavino 1999), and has recently been identified in sexual progeny of the US-6 lineage (Gavino et al 2000).
The present study was undertaken to expand our knowledge of the population genetics of P. infestans through analysis of mitochondrial diversity. First, the two mitochondrial nomenclature systems were experimentally reconciled and the relationships among haplotypes were determined. Then we tested the hypotheses that: (i) haplotype I-b is ancestral to the other haplotypes; (ii) haplotype I-b is extant in the population from central Mexico; and (iii) all haplotypes occur in many different nuclear backgrounds. Our initial approach was to apply both the system devised by Carter et al (1990) as modified by Griffith and Shaw (1998) and the Southern analysis of Goodwin (1991) to a common set of isolates known to be diverse for mtDNA haplotype. We also examined other regions of the mitochondrial genome to find additional polymorphisms that might help determine relationships among the various haplotypes.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
).
|
, Koh et al 1994). Briefly, total DNA was extracted from isolates to be assayed, digested with Eco RI, subjected to agarose gel electrophoresis and blotted to nylon membrane. The mtDNA, to be used as a probe, was isolated by centrifugation with cesium chloride-bisbenzimide (Garber and Yoder 1983) and labeled with 32P. Haplotypes were identified based on RFLP fingerprints as described by Goodwin (1991) and Koh et al (1994).
Carter's haplotypes were determined using the PCR-RFLP method devised by Griffith and Shaw (1998). Primer pairs 1(F5' GCAATGGGTAAATCGGCTCAA 3' and R5' AAACCATAAGGACCACACAT 3'), 2 (F5' TCCCTTTGTCCTCTACCGAT 3' and R5' GCTTATGCTTCAGTTGCTCAT 3'), and 4 (F5' TGGTCATCCAGAGGTTT ATGTT 3' and R5' CCGATACCGATACCAGCACCAA 3') designed by Griffith and Shaw (1998) were used to amplify mtDNA by PCR. Primer pair 3 by Griffith and Shaw (1998) was not used in this study because it did not provide any additional information. Each PCR reaction (100 µL) consisted of 1 x Thermo buffer (50 mM KCl, 10 mM Tris-HCl), 2.75 mM MgCl2, 200 µM dNTPs, 0.325 µM each primer, 5 units Taq DNA polymerase, and 100 ng DNA. Amplification was conducted with one cycle of 94 C for 90 s followed by 40 cycles of 94 C for 40 s, 55 C for 60 s, and 72 C for 90 s (Griffith and Shaw 1998). The PCR products were separated on 2% agarose gels and visualized with ethidium bromide using standard techniques. The products (P1, P2, and P4) were numbered according to the primer pairs used for amplification and digested with specific restriction enzymes. The following sizes were expected for products: P1 = 1.1 Kb, P2 = 1.2 Kb, and P4 = 0.96 Kb. Products P1, P2, and P4 were digested with Cfo I, Msp I, and Eco RI, respectively. Haplotypes I-a, I-b, II-a, and II-b were identified by their restriction patterns as described by Griffith and Shaw (1998) following the mtDNA nomenclature system of Carter et al (1990).
Relationships among haplotypes – Specific mutations distinguishing the different haplotypes were identified. First, fragment sizes cleaved by Eco RI during Southern analysis were compared with those expected based on analysis of the full-length mtDNA sequence (haplotype I-b) provided by Dr. Franz Lang (http://megasun.bch.umontreal.ca/People/lang/FMGP). Second, the length mutations in haplotypes E and F were verified by Southern analysis using the PCR product P4 as probe. This probe was chosen because it had the potential to detect insertions or deletions in three Eco RI fragments (5.7 Kb, 0.4 Kb, and 6.5 Kb) as shown in Fig. 1.
|
).
Analysis of additional regions of the mtDNA –
Additional diversity was sought by analyzing other portions of the mitochondrial genome in a subset of the isolates from central Mexico. Three additional primer pairs were designed: primer pair 5 (F5' AAGGGAAGGTAGCATAGTCTGG 3' and R5' AAAAGTTTGGGCCGTGTCTC 3'), primer pair 6 (F5' GAGTATTAGCCTTCTAAGC 3' and R5' CTGTTTTACCGAGATATCG 3'), and primer pair 7 (F5' TCCTCTAACGGG TAATCCTTGAC 3' and R5' AACGACCTTTAAATTGTAGACGA 3'). The following sizes were expected for products P5 = 2.5 Kb, P6 = 0.64 Kb, and P7 = 1.98 Kb. Primer pair 5 was designed to amplify a large region including the site for the 2 Kb insertion (Fig. 1) and was also used to amplify P. mirabilis (isolates OS-16 and OS-18), a close relative that served as an outgroup for comparisons. The conditions to amplify P5 were as follows: 1 cycle of 94 C for 90 s and 40 cycles of 94 C for 40 s, 55 C for 3 min, and 72 C for 90 s. Primer pair 6 was designed to amplify the region containing inverted repeats which is thought to be variable in mtDNAs of oomycetes and chromophytic algae (Coleman et al 1991). P6 includes the nad 4L and nad 1 genes in P. infestans and P. mirabilis. The conditions to amplify P6 and P7 were the same as those used for P1, P2, and P4. Some PCR products were digested with restriction enzymes to assay more mtDNA sites in the subset of 30 isolates from central Mexico: P4 + Dra I, P5 + Dra I, P7 + Dra I, P7 + Eco RI, P7 + Rsa I, and P7 + Taq I. The digested fragments were separated by electrophoresis on 2% agarose gel and visualized by staining with ethidium bromide.
Search for additional mitochondrial haplotypes among additional isolates –
A large sample of isolates (n = 548) obtained from the Phytophthora Culture Collection at Cornell University (Forbes et al 1998) was analyzed for mtDNA haplotype. The sample included isolates from 24 countries on six continents (Table II). The largest number of isolates had been obtained from Mexico (n = 137) with 18 from northeast Mexico, 32 from northwest Mexico, and 87 from central Mexico. Haplotypes Ia, Ib, IIa, and IIb were determined using the PCR-RFLP method (Griffith and Shaw 1998) as described above. The haplotypes according to Goodwin were determined by Southern analysis, using purified mtDNA (Goodwin 1991, Koh et al 1994). The nuclear genetic background (allozymes and RG57 fingerprint) of approximately 75 isolates had not been determined previously, so these data were generated using routine methods (Goodwin et al 1992a, 1995).
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
T that resulted in the loss of a Msp I site in P2 region of haplotype I-a(A) (Fig. 1).
Carter's haplotype I-b included haplotypes E and F as well as A (Table I) for which new designations are I-b(E) and I-b(F) as well as I-b(A) in Fig. 1. As Koh et al (1994) noted, the Eco RI restriction patterns of haplotypes I-b(A), I-b(E), and I-b(F) were identical, except that the 5.7 Kb band was absent in both haplotypes I-b(E) and I-b(F) (Fig. 2). Moreover, haplotype I-b(F) has a unique 6.1 Kb band as shown in Fig. 2A (Koh et al 1994). In this study, probe P4 hybridized more strongly to the 5.7 Kb band than the 6.5 Kb band in haplotype I-b(A) as expected because of sequence similarity (Fig. 2B). In contrast, probe P4 hybridized intensely to the 6.5 Kb band of haplotype I-b(E) suggesting that there could be two fragments of the same 6.5 Kb size. It may be possible that a 0.8 Kb fragment inserted into the 5.7 Kb fragment yielding the second 6.5 Kb band (Fig. 1). On the other hand, probe P4 hybridized equally to bands 6.5 Kb and 6.1 Kb in haplotype I-b(F) (Fig. 2B) indicating that a 0.4 Kb fragment may have inserted into the 5.7 Kb fragment generating the 6.1 Kb band (Fig. 1).
|
for haplotype group II was confirmed by amplification with primer pair 5. The size of P5 for haplotypes II-a and II-b was 4.5 Kb compared to 2.5 Kb for haplotypes I-a, I-b, and P. mirabilis (data not shown).
Nucleotide substitutions differentiated other haplotypes. II-a and II-b were additionally distinguished from I-b(A) by several substitutions: (i) in the P1 region a change from CT resulted in the loss of a Cfo I site; (ii) in the P2 region a change from CT resulted in the loss of an Msp I site; (iii) in the P4 region a change from CT resulted in the loss of an Eco RI site; and (iv) in the P6 region there was a change from AT (Fig. 1). Only two nucleotide substitutions distinguished haplotype II-a from II-b (Fig. 1). In P2 region, a substitution from TC resulted in the presence of a second Msp I site in haplotype II-a but not in II-b.
Our search for additional variation in P. infestans mtDNAs had limited success. Sequences for genes nad 4L and nad 1 in P6 were identical for all four haplotypes (I-a, I-b, II-a, and II-b) of P. infestans and the two isolates of P. mirabilis. However the region of inverted repeats flanking the two genes provided limited nucleotide differences (Fig. 1). Haplotypes I-a and I-b were identical in the inverted repeat region of P6, but differed from haplotypes II by a common nucleotide (AT) (Fig. 1). Additionally, haplotype II-b differed from II-a by one nucleotide (GA) in this inverted repeat region of P6 (Fig. 1).
Relationships among haplotypes – The characterizations of the six mtDNA haplotypes illustrate how they differ from each other. The 2 Kb insert characteristic of haplotype group II was absent in P. mirabilis, suggesting that the ancestral mtDNA of P. infestans belongs to group I (Fig. 1). Haplotypes I-a(A), I-b(E), and I-b(F) each differed from I-b(A) by one unique change. No other haplotype was related to all of the others by only a single difference. Thus, each haplotype could have been derived from I-b(A). Haplotypes II-a and II-b differed from I-b(A) by several common changes, but they differ from each other by only a few changes, and appear to be closely related.
mtDNA in the Toluca Valley –
There was only a single mtDNA haplotype (I-a) detected in isolates from the region of the Toluca Valley (Table III). This confirms the earlier suggestion by Goodwin (1991) that this population (with the greatest nDNA diversity) has very limited mtDNA diversity. The isolates from Toluca were obtained mainly from commercial potato cultivars such as Alpha and Rosita, while a few isolates (n = 5) were from wild species (data not shown). The monomorphic nature of haplotypes in the isolates from Toluca was maintained even after additional mtDNA restriction sites were assayed in a subset of 30 isolates. Uniform restriction patterns were observed when the following PCR products were digested with the following restriction enzymes: P4 + Dra I, P5 + Dra I, P7 + Dra I, P7 + Eco RI, P7 + Rsa I, and P7 + Taq I. Moreover, five isolates from Calimaya, Metepec, and Atizapan in Toluca had exactly the same 182 bp sequence of the P2 region.
|
|
|
Other mtDNA haplotypes were found in association with many different nuclear genomes. Haplotype I-a(A) was found among diverse nDNA genotypes and clonal lineages worldwide (Table IV). In the United States and Canada, haplotype I-a(A) was associated with the nDNA genotypes US-7 and US-8. It was also found among several clonal lineages from Peru, Argentina, Brazil, Rwanda, and Israel. Haplotypes I-a and II-a were present in Europe among diverse nDNA genotypes consisting of A1 and A2 mating types (Tables III, V). Haplotype II-a was found in Japan and Korea (Table V) associated with the JP-1 genotype. In South America, haplotype II-a was found in several clonal lineages however II-a was not found in the USA or Canada (Table V).
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Knowledge of insertions and nucleotide substitutions allowed us to propose relationships among the haplotypes (Fig. 1), and to test our first hypothesis that haplotype I-b(A) is ancestral to the other known haplotypes. The relationships are shown in Fig. 1 as a minimum length tree with no character reversals inferred. Haplotypes in group I were distinguished from those in group II by a 2 Kb insertion (Carter et al 1990) localized in the P5 region (Fig. 1). Because we did not find the 2 Kb insert in the P5 region of P. mirabilis mtDNA (Fig. 1) we believe that the ancestral mtDNA belongs to group I. Further, it is plausible that haplotypes I-b(E) and I-b(F) were derived from haplotype I-b(A) especially since they all have the same nDNA background (Fig. 2) (Koh et al 1994). Intriguingly, three insertions were located in the same mtDNA region within the 5.7 Kb Eco RI fragment (Fig. 1). This region may be less constrained in contrast to the rest of P. infestans mtDNA. From all of these data, we cannot reject our first hypothesis that haplotype I-b(A) is the putative ancestral mitochondrial haplotype of P. infestans. However, while we expect that haplotype I-b(A) is the ancestral form, we cannot completely reject the hypothesis that haplotype I-a(A) might be the ancestral haplotype since haplotypes I-a(A) and I-b(A) differ from each other by only a single nucleotide. Sequence comparison based on a larger part of the mitochondrial genome of P. infestans and its close relatives will be necessary to determine the actual ancestral relationships.
We were unable to find haplotype I-b(A) in any isolates recently obtained from Mexico, causing us to tentatively reject our second hypothesis (that central Mexico would contain this haplotype). While a sample size of 137 isolates cannot enable us to state absolutely that haplotype I-b(A) is absent from Mexico, we can certainly conclude that if present, it is at low frequency. Our detection of only haplotype I-a (A) in isolates from central Mexico contrasts with our expectation of finding some mitochondrial diversity coincident with the greatest nuclear diversity. Indeed, these data lead to contrasting hypotheses, including this one: that the widespread distribution of a single mtDNA haplotype in the Toluca Valley of central Mexico is perhaps due to selection. There are reports of non-neutral mutations in mtDNA in several organisms (Fos et al 1990, Rand and Kann 1996, Rand et al 1994), so that this hypothesis is certainly not without precedent.
While our data are consistent with selection acting on mtDNA in P. infestans in central Mexico we have not confirmed a mechanism. One possible mechanism might be that domestic potatoes provide a different environment and therefore selected different mtDNA than did wild Solanum spp. A precedent has been suggested in the fungus Mycosphaerella graminicola. The limited mtDNA variation in that fungal pathogen might have been caused by a selective sweep that occurred as populations became specialized to infect bread wheat (McDonald et al 1999). If a similar event occurred in the P. infestans–Solanum spp. pathosystem it needs to explain the previous worldwide occurrence of haplotype I-b (A) on potatoes, and the current occurrence of haplotype I-a (A) on diverse Solanum spp. in central Mexico. First, the worldwide distribution of haplotype I-b(A) on potatoes could be explained by hitchhiking with a particular nuclear genotype. Second, the occurrence of haplotype I-a (A) on diverse native Solanum spp. in central Mexico (n = 5 in our sample) could be explained by the relatively recent (latter half of the 20th century), but currently strong, influence of very extensive and intensive production of domestic potatoes in central Mexico.
A test of the non-neutral effect of mtDNA haplotype I-b(A) relative to other haplotypes is possible experimentally. Progeny of a cross between an isolate containing haplotype I-b(A) and an isolate containing I-a (A) would produce a population of genetically diverse individuals containing either mtDNA I-b (A) or I-a (A). Pathogenic fitness tests done on these progeny in a manner similar to that done by Day and Shattock (1997) would reveal fitness differences attributable to mtDNA haplotype. Such tests await the development of the proper progeny.
Our third hypothesis was that all haplotypes would occur in a variety of nuclear backgrounds. While haplotypes I-a and II-a certainly occurred in many different nDNA genotypes, this was not the situation for haplotypes I-b and II-b. Haplotype I-b was found only in isolates and variants of the US-1 clonal lineage (Table IV). This lineage contains some nuclear diversity, but all individuals appear to be related and to differ from each other only by a small number of mutations (Table IV). Variant haplotypes I-b(E) and I-b(F) appeared to have arisen from haplotype I-b(A) by independent mutations. In addition, haplotype II-b was also found in a very limited number of nuclear backgrounds mainly involving the US-6 clonal lineage (A1 mating type), or its derivatives (Gavino 1999, Gavino et al 2000). This lineage had a distribution of western Canada, western United States and northwestern Mexico (Fry and Goodwin 1997, Goodwin et al 1998). Previously, Goodwin et al (1998) reported that US-6 lineage was introduced into the United States and Canada from northwestern Mexico in the 1970s. Griffith and Shaw (1998) also found haplotype II-b only in the United States and Canada, but they found it among A1 and A2 mating types. Their sample from these two countries was different from ours, and the reports of sexual reproduction in northern North America are certainly consistent with the distribution of this haplotype in diverse nuclear backgrounds in this region. In fact, in a subsequent study, we learned that haplotype II-b occurs in the US-11 lineage, a lineage that has continental distribution and which probably arose very recently via sexual recombination involving the US-6 lineage (Gavino et al 2000).
A pattern of slow evolution in the mtDNA of oomycetes is emerging. The small size and conservation of mtDNAs appear to be universal in oomycetes and their algal relatives (Chesnick et al 1996, 2000). The uniformity in oomycete mtDNAs is in contrast to the non-uniformity in mtDNAs of some true fungi (McNabb and Klassen 1988). Many fungi possess isolate- and species-specific variations in mtDNAs (Garber and Yoder 1983, Taylor 1986). Low mtDNA variation, however, also exists in some fungi such as Fusarium oxysporum f. sp. canariensis (Plyler et al 2000), Chondrostereum purpureum (Ramsfield et al 1999), and Ceratocyctis fagacearum (Kurdyla et al 1995). Unlike fungal mtDNAs, mtDNAs of P. infestans and P. megasperma do not have introns (Förster et al 1987, Paquin et al 1997). The sequences of four mtDNA genes (l-rRNA, s-rRNA, oxi-2, and cob) are the same for P. megasperma f. sp. glycine, P. megasperma f. sp. medicaginis, and P. parasitica var. nicotianae (Förster et al 1987). In another study, microsatellites for P. cinnamomi mtDNA were not highly polymorphic (Dobrowolski et al 1998). Möeller et al (1993) even considered P. mirabilis a forma specialis of P. infestans because of very high similarity in their mtDNA restriction patterns. Sequence conservation in P. infestans mtDNA is consistent with the fact that more than 95% of the genome codes for genes (Paquin et al 1997).
Our study has used the mitochondrial genome as a tool to investigate questions concerning the evolution and population genetics of P. infestans. We reconciled two existing nomenclature systems for mtDNA haplotypes and suggested a hypothetical common ancestor. The diversity in the I-b haplotype is consistent with the hypothesis that this is the oldest of the extant haplotypes and is also consistent with the hypothesis that the US-1 lineage in which it is found is the oldest of extant lineages. Our study with the mitochondrial genome confirmed previous hypotheses concerning migrations of P. infestans, but it also generated novel hypotheses. The most surprising of these was the hypothesis that selection might be driving mtDNA haplotype I-a(A) to approach fixation in the Toluca Valley of central Mexico. Identification of the forces causing that selection awaits further investigation.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Accepted for publication February 27, 2002.
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
———, ———, ———, ———, ———. 1991 DNA polymorphisms in Phytophthora infestans: the UK experience. In: Lucas JA, Shattock RC, Shaw DS, Cooke LR, eds. Phytophthora. Cambridge, England: Cambridge University Press. p 272–294
Chesnick JM, Goff M, Graham J, Ocampo C, Lang BF, Seif E, Burger G., 2000 The mitochondrial genome of the stramenopile alga Chrysodidymus synuroides. Complete sequence, gene content and genome organization. Nuc Acid Res 28:2512-2518
———, Tuxbury K, Coleman A, Burger G, Lang BF., 1996 Utility of the mitochondrial nad 4L gene for algal and protistan phylogenetic analysis. J Phycol 32:452-456
Coleman AW, Thompson WF, Goff L., 1991 Identification of the mitochondrial genome in the chrysophyte alga Ochromonas danica. J Protozool 38:129-135
Day JP, Shattock RC., 1997 Aggressiveness and other factors relating to displacement of populations of Phytophthora infestans in England and Wales. Eur J Plant Pathol 103:379-391
DNASTAR. 1994 Lasegene: biocomputing software for WINDOWS. Madison, Wisconsin
Dobrowolski MP, Tommerup IC, O'Brien PA., 1998 Microsatellites in the mitochondrial genome of Phytophthora cinnamomi failed to provide highly polymorphic markers for population genetics. FEMS Microbiol Letters 163:243-248[Medline]
Forbes GA, Goodwin SB, Drenth A, Oyarzun P, Ordonez ME., 1998 A global marker database for Phytophthora infestans. Plant Dis 82:811-818
Förster H, Kinscherf TG, Leong SA, Maxwell DP., 1987 Molecular analysis of the mitochondiral genome of Phytophthora. Curr Genet 12:215-218
Fos M, Dominguez MA, Latorre A, Moya A., 1990 Mitochondrial DNA evolution in experimental populations of Drosophila pseudoobscura. Proc Nat Acad Sci USA 87:4198-4201
Fry WE, Goodwin SB., 1997 Re-emergence of potato and tomato late blight in the United States. Plant Dis 81:1349-1357
———, ———, Dyer AT, Matuzak JM, Drenth A, Tooley PW, Sujkowski LS, Koh YJ, Cohen BA, Spielman LJ, Deahl KL, Inglis DA, Sandlan KP., 1993 Historical and recent migrations of Phytophthora infestans: chronology, pathways, and implications. Plant Dis 77:653-661
Garber RC, Yoder OC., 1983 Isolation of DNA from filamentous fungi and separation into nuclear, mitochondrial, ribosomal, and plasmid components. Anal Biochem 135:416-422[Medline]
Gavino PD., 1999 Mitochondrial DNA evolution and its utility for population genetic studies of Phytophthora infestans [PhD Dissertation]. Ithaca, New York: Cornell University. 94 p
———, Smart CD, Sandrock RW, Miller JS, Hamm PB, Yun Lee T, Davis RM, Fry WE., 2000 Implications of sexual reproduction for Phytophthora infestans in the United States: generation of an aggressive lineage. Plant Dis 84:731-735
Goodwin SB., 1991 DNA polymorphisms in Phytophthora infestans: the Cornell experience. In: Lucas JA, Shattock RC, Shaw DS, Cooke LR, eds. Phytophthora. Cambridge, England: Cambridge University Press. p 256–271
———. 1997 The population genetics of Phytophthora. Phytopathology 87:462-473
———, Cohen BA, Fry WE., 1994 Panglobal distribution of a single clonal lineage of the Irish potato famine fungus. Proc Nat Acad Sci USA 91:11591-11595
———, Drenth A, Fry WE., 1992a Cloning and genetic analyses of two highly polymorphic, moderately repetitive nuclear DNAs from Phytophthora infestans. Curr Genet 22:107-115[Medline]
———, Schneider RE, Fry WE., 1995 Use of cellulose-acetate electrophoresis provides rapid identification of allozyme genotypes of Phytophthora infestans. Plant Dis 79:1181-1185
———, Smart CD, Sandrock RW, Deahl KL, Punja ZK, Fry WE., 1998 Genetic change within populations of Phytophthora infestans in the United States and Canada during 1994 to 1996: role of migration and recombination. Phytopathology 88:939-949
———, Spielman LJ, Matuzack JM, Bergeron SN, Fry WE., 1992b Clonal diversity and genetic differentiation of Phytophthora infestans populations in northern and central Mexico. Phytopathology 82:955-961
Griffith GW, Shaw DS., 1998 Polymorphisms in Phytophthora infestans: four mitochondrial haplotypes are detected after PCR amplification of DNA from pure cultures or from host lesions. Appl Environ Microbiol 64:4007-4014
Klimczak LJ, Prell HH., 1984 Isolation and characterization of mitochondrial DNA of the oomycetous fungus Phytophthora infestans. Curr Genet 8:323-326
Koh Y J, Goodwin SB, Dyer AT, Cohen BA, Ogoshi A, Sato N, Fry WE., 1994 Migrations and displacements of Phytophthora infestans populations in east Asian countries. Phytopathology 84:922-927
Kurdyla TM, Guthrie PAI, McDonald BA, Appel DN., 1995 RFLPs in mitochondrial and nuclear DNA indicate low levels of genetic diversity in the oak wilt pathogen Ceratocyctis fagacearum. Curr Genet 27:373-378[Medline]
Lang BF, Forget L., 1993 The mitochondrial genome of Phytophthora infestans. In: O'Brien SJ, ed. Genetic maps. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. p 3.133–3.135
McDonald BA, Zhan J, Yarden O, Hogan K, Garton J, Pettway RE., 1999 The population genetics of Mycosphaerella graminicola and Phaeosphaeria nodorum. In: Lucas JA, Bowyer P, Anderson HM, eds. Septoria in Cerals: a study of pathosystems. Wallingford, United Kingdom: CABI Publishing. p 44–69
McNabb SA, Klassen GR., 1988 Uniformity of mitochondrial DNA complexity in Oomycetes and the evolution of the inverted repeat. Exp Mycol 12:233-242
Möeller EM, De Cock AWAM, Prell HH., 1993 Mitochondrial and nuclear DNA restriction enzyme analysis of the closely related Phytophthora species P. infestans, P. mirabilis, and P. phaseoli. J Phytopathol 139:309-321
Paquin B, Laforest MJ, Forget L, Roewer I, Wand Z, Langcore J, Lang BF., 1997 The fungal mitochondrial genome project: evolution of fungal mitochondrial genomes and their gene expression. Curr Genet 31:380-395[Medline]
Plyler TR, Simone GW, Fernandez D, Kistler HC., 2000 Genetic diversity among isolates of Fusarium oxysporum f. sp. canariensis. Plant Pathology 49:155-164
Ramsfield TD, Shamoun SF, Punja ZK, Hintz WE., 1999 Variation in the mitochondrial DNA of the potential biological control agent Chondrostereum purpureum. Can J Bot 77:1490-14498
Rand DM, Kann LM., 1996 Excess amino acid polymorphisms in mitochondrial DNA: contrasts among genes from Drosophila, mice and humans. Mol Bio Evol 13:735-748[Abstract]
———, Dorfsman ML, Kann LM., 1994 Neutral and non-neutral evolution of Drosophila mitochondrial DNA. Genetics 138:741-756[Abstract]
Taylor JW., 1986 Fungal evolutionary biology and mitochondrial DNA. Exp Mycol 10:259-269
This article has been cited by other articles:
 |
|
 |
|
  L. Gomez-Alpizar, I. Carbone, and J. B. Ristaino An Andean origin of Phytophthora infestans inferred from mitochondrial and nuclear gene genealogies PNAS, February 27, 2007; 104(9): 3306 - 3311. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) were found in haplotypes I-b(E), I-b(F), II-a(B), and II-b(B). Single nucleotide substitutions (