| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Microbial Genomics and Bioprocessing Research Unit, National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Illinois 61604
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
DNA sequences were determined for beta tubulin (BT2), calmodulin (CF), ITS and lsu rDNA (ID) and RNA polymerase II (RPB2) from ca. 460 Aspergillus isolates. RPB2 and rDNA sequences were combined and analyzed to determine relationships in the genus and in the family Trichocomaceae. Eupenicillium species form a statistically supported clade with origins among the Aspergillus clades. A. crystallinus, A. malodoratus and H. paradoxus are members of the Eupenicillium clade. A. zonatus, A. clavatoflvus and W. spinulosa occur in a clade along with Hamigera sp. Other than these exceptional species, Aspergillus species and sections occur on three strongly supported clades that descend from a polytomy. Section Versicolores as a monophyletic group includes only A. versicolor and A. sydowii and is superfluous. The other sections were retained but modified. All four loci were used in genealogical concordance analysis of species boundaries. Fennellia flavipes and F. nivea are not conspecific with their supposed anamorphs A. flavipes and A. nivea. Synonymies were found for some species and more than 20 undescribed taxa were identified in genealogical concordance analysis. Newly discovered taxa will be described elsewhere. Possibly paralogous gene fragments were amplified with the BT2 primers in sections Nidulantes, Usti and Nigri. Use of nonhomologous sequences in genealogical concordance analysis could lead to false conclusions and so BT2 sequences were not used in analysis of those sections.
Key words: Aspergillus brevijanus comb. nov., beta tubulin, calmodulin, concordance analysis, Dichotomomyces, RNA polymerase II, Talaromyces, Thermoascus, Trichocomaceae
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
) or section (Gams et al 1985) and resolved to a greater or lesser extent the taxonomic hypotheses within the group (Peterson 1995, Frisvad et al 2004, Varga et al 2005). Peterson (2000) assessed phylogenetic relationships across Aspergillus using partial lsu rDNA (ca. 650 nt) but had little statistical support for many nodes. More recent genomic studies (Galagan et al 2005) have shown different relationships for some of the species Peterson (2000) examined suggesting a reevaluation of Aspergillus using a larger set of data that might provide greater statistical support in the tree.
This multilocus data have been used in two ways. Species boundaries were examined with genealogical concordance phylogenetic species recognition (GCPSR) (Taylor et al 2000, Dettman et al 2003a, b, 2006) and data from different loci were combined into a single dataset for evaluating the broader relationships of species and sections in Aspergillus. The multiple loci and increased number of nucleotides in the combined dataset have improved statistical support compared to prior single locus studies (e.g. Peterson 2000). Knowing the broad relationships in Aspergillus will be valuable for putting other data (phenotypic, extrolite, pathogenicity) into phylogenetic perspective. The DNA sequences with concordance analysis provide the necessary information to define species and provide sequence data for DNA-based detection and identification of medically, industrially and agriculturally important species (Hinrickson et al 2005, Page and Kurtzman 2005, Serra et al 2006).
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
DNA extraction.— –
DNA was extracted with mechanical grinding, phenol-chloroform protein extraction, ethanol precipitation, and final purification on a silica matrix using NaI chaotropic agent as detailed elsewhere (Serra and Peterson 2007).
PCR amplification.— –
Beta-tubulin was amplified (ca. 450 nt) with the BT2 primer set and protocol of Glass and Donaldson (1995). Calmodulin (CF) was amplified (ca. 650 nt) using the protocols of Serra and Peterson (2007) with primer (5') CF1L 5'–gccgactctttgacygargar or CF1M 5'–aggccgaytctytgacyga and (3') CF4 5'–tttytgcatcatragytggac. The ITS1, 5.8s rDNA, ITS2 and ca. 650 nt of lsu rDNA (ID region, ca. 1150 nt) was amplified and sequenced using the method of Serra and Peterson (2007). RNA polymerase II (RPB2) was amplified with primers and conditions detailed by Liu et al (1999), specifically the fragment (ca. 1100 nt) amplified with primers 5F and 7CR. The fragment was sequenced with the terminal primers plus 527R 5'–gggtcccgatgrayaccaacc and 388F 5'–cagctacacaacacycaytgg. BT2 and CF were sequenced using the terminal primers. Bidirectional sequencing was performed for all loci and isolates. Sequencing errors were detected and corrected with Sequencher (Gene Codes, Ann Arbor Michigan).
Data analysis.— –
DNA sequences were aligned with Clustal W (Thompson et al 1994). For the beta tubulin sequences, a 24 base leader sequence (gatcgatcgatcgatcgatcgatc) sometimes was inserted before the first base of the sequences forcing Clustal W to align the first two bases of sequence even though a length-variable intron sequence follows immediately after the first two bases. After alignment the leader elements were trimmed off. PAUP* (Swofford 2003) was used to generate phylograms for each dataset with the methods of Dettman et al (2003a, 2006), that is maximum parsimony, nni branch swapping and 500 random sequence additions, followed by TBR branch swapping using the random sequence addition trees as the starting point for the TBR heuristic search. Three or four locus combined datasets were made and subjected to weighted parsimony with the weight for each locus calculated as the number of parsimony informative characters for the least variable locus divided by the parsimony informative characters of that locus. Bootstrapping (bs) was performed in PAUP* with sequence addition "as is" and TBR branch swapping for 1000 replicates. MrBayes 3.1.2 (Huelsenbeck and Ronquist 2001, Ronquist and Huelsenbeck 2003) was used to calculate the posterior probabilities (pp) of branches. Mostly default settings were used. BT2 and CF loci were partitioned into intron and exon regions, ID was partitioned into ITS1, 5.8S rDNA, ITS2 and 28S rDNA regions, and RPB2 was analyzed allowing codon positions 1, 2 and 3 to be independent datasets. A general time reversible model was used with gamma and invariants calculated and base frequencies from the sample. MCMC analysis with 5 x 105 generations was used initially but some datasets did not converge until after 5 x 106 generations and were subjected to as many as 107 generations of analysis.
Introns were excluded from analysis when the entire genus (FIG. 2) was being examined because particular introns were missing in some species and loci, and the length and sequence differences of introns across the genus made alignment impossible. Similarly the ITS1 and ITS2 regions were excluded from the whole genus analysis because length and sequence differences made meaningful alignment impossible. The BT2 and CF loci were excluded from all-Aspergillus comparisons because of possible non-homology of some amplicons.
|
, 2006) were used to identify genealogical concordance. An independent evolutionary lineage was recognized if three of the four loci identified a clade or if a clade was strongly supported by bs proportions and Bayesian pp at one locus and no other locus was strongly supported in a contradictory topology. Monophyly was required for all taxa.
Sequence information from all four loci was included in alignments and used in the combined data analysis of the Aspergillus subgroups (FIGS 3–5 and 5–10. FIGS 6, 11 and 12 were calculated using the combined data from CF, ID and RPB2.)
|
|
|
|
|
|
|
|
|
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
DNA amplification with the BT2 primers among isolates from section Nigri produced amplicons with either two or three introns. Amplification products from four A. japonicus-like isolates were the two-intron form of beta tubulin, while amplification products from four other A. japonicus-like isolates and other species in section Nigri were the three-intron form of the gene fragment. FIG. 1 and FIG. 6
respectively show the parsimony trees produced using data from BT2 or from the concordant loci CF, ID and RPB2 combined. The A. japonicus-like isolates in the BT2 tree (FIG. 1) form two statistically supported groups with two-intron isolates forming one monophyletic group and three-intron isolates forming a different monophyletic group. By comparison (FIG. 6) the combined data from the other three loci and each locus analyzed independently have all uniseriate (A. japonicus-like) isolates on a single strongly supported branch (single-locus trees not shown). Paralogy is suspected because the BT2 tree is strongly contradictory to the other three loci and the beta tubulin has a different intron structure.
|
) represents a paralogous gene. Sufficient doubt about the homology of the two-intron and three-intron beta tubulin exists (FIGS. 1, 6) so that BT2 was not used in the analysis of sections Emericella, Usti or Nigri. The CF fragment amplified from more than 99% of the isolates included five exon and four intron sequences. In the case of Aspergillus candidus and A. campestris one of the introns is missing from the amplified fragment. The CF sequences aligned with a total length of 872 nt of which 475 nt code intron sequences and 397 nt code for amino acids.
The ID region sequences had an aligned length of 1275 nt. ITS1 included 246 aligned bases and ITS2 included 223 aligned bases. The ITS regions were excluded from analysis of the most distant relationships (FIG. 2) due to alignment problems, but the ITS regions were included in analysis of closely related organisms where the alignments were possible.
The RPB2 fragment was amplified with primers 5f and 7cr (Liu et al 1999) and from that amplification, homologous fragments of length 1008, 1011 or 1014 were retained and they aligned with a length of 1017 nt. RPB2 contains no intron sequences.
A subset of the data was assembled with some species from each Aspergillus section, Eupenicillium, Talaromyces, Hamigera, Thermoascus, Byssochlamys, and Trichoma species. Some of these species were examined by Lobuglio and Taylor (1993), Berbee et al (1995), Ogawa et al (1997) and Geiser et al (2006) but with only limited resolution in the Trichocomaceae. Only 5.8S rDNA, 28S rDNA sequences and the RPB2 sequences were used in this dataset. It was analyzed using MrBayes with three data partitions, each under a GTR model with invariants and gamma and rates in each partition were independent. MCMC analysis was run for 106 generations with four heated chains. The first 105 generations were omitted as burn-in. The consensus tree from that analysis is provided (FIG. 2). Bootstrap values also were calculated, as detailed in METHODS and shown on the tree diagram.
Consensus tree.— –
The majority of species with Aspergillus anamorphs occur on three unresolved branches that each have 95–100% support by posterior probabilities (pp). The topmost of the strongly supported branch includes parts or all of 10 sections. Sections Terrei and Flavipedes are siblings whose membership does not correlate with that of Raper and Fennell (1965). Species of Fennellia are in section Flavipedes while A. niveus the purported anamorph of F. nivea is in section Terrei. A. microcysticus and A. ambiguus (section Versicolores) are members of section Terrei. The sections and the node uniting these sections as siblings have strong support from bs and pp. Section Candidi appears next (FIG. 2) but the low pp suppport makes this placement questionable. Section Nigri (no known teleomorph) and section Flavi (Petromyces teleomorph) are sibling sections with strong statistical support, but the low support at the node uniting these sections with the rest of the genus leaves their exact placement in question. Section Circumdati, including A. robustus, and section Cremei are both well supported statistically as sections. Three other sections, Fumigati, Clavati and Cervini, occur on a strongly supported branch with each of the sections also well supported statistically.
The second branch from the polytomy unites sections Nidulantes, Usti and Sparsi. Each section is well supported statistically. Section Versicolores is contained within section Nidulantes and as a monophyletic group contains only A. versicolor and A. sydowii. The third branch from the polytomy strongly unites section Aspergillus and Restricti as sibling sections.
Basal to the polytomy is a strongly supported (1.00 pp) branch that contains Warcupiella spinulosa, Aspergillus zonatus, Aspergillus clavatoflavus, and Penicilliopsis clavariiformis along with Talaromyces leycetanus, Hamigera avellanea and Monascus purpurea. Another basal branch contains Eupenicillium species as well as A. malodoratus, A. crystallinus and Hemicarpenteles paradoxa. The Eupenicillium branch has 80% bs and 1.00 pp statistical support. The species of Sclerocleista (section Ornati) form a basal clade with 1.00 pp support. Other species attributed to section Ornati (H. paradoxus, W. spinulosa, A. raperi and A. brunneouniseratus) occur in several different branches of the tree. Basal to Aspergillus species are Thermoascus, Byssochlamys, Talaromyces, Geosmithia and Trichoma.
On the basis of the cladogram (FIG. 2) more detailed trees were calculated including all available species from the sections defined in FIG. 2.
Sections Aspergillus and Restricti and Eurotium species.— –
Fifteen species are distinguished in the section Aspergillus clade and eight species are present in the section Restricti clade (FIG. 3) on the basis of congruence analysis of the four loci. The type isolate of each lineage is shown in boldface in the tree diagram. Isolates whose identification is in question are given the name they previously have been identified as, but the name is surrounded by quotation marks.
The E. echinulatum lineage is represented by the type isolate, the type isolate of E. medium, and A. brunneus NRRL 133 (anamorph of E. echinulatum). Because of priority E. medium is a synonym of E. echinulatum. The sibling species of E. echinulatum is E. niveoglaucum.
A. proliferans is the only anamorphic species assigned to the "A. glaucus group" (Raper and Fennell 1965). Two isolates of Eurotium, NRRL 71 and NRRL 114 were described respectively as representative of the E. rubrum isolates with larger cleistothecia and zonate conidial areas (NRRL 71) and "may represent a strain transitional between A. mangini and A. ruber" (NRRL 114) (Raper and Fennell 1965). These three isolates form a monophyletic group and the two Eurotium isolates represent the teleomorphic state of A. proliferans.
Two isolates of E. herbariorum and two isolates of E. umbrosum form a clade supported by all four loci (FIG. 3). The E. herbariorum lineage is statistically supported by two loci while the E. umbrosum lineage is strongly supported in the other two loci. E. carnoyi consistently branches with the four species mentioned above. Low bs and pp values leave the exact relationship of E. carnoyi to the other species unresolved (FIG. 3).
The E. repens lineage includes the type isolate, an isolate of A. reptans (anamorphic state), the type isolate of E. pseudoglaucum and one other E. repens isolate. E. pseudoglaucum is a synonym of E. repens on the basis of congruence and priority. The E. rubrum lineage is represented by the type and one nontype isolate plus the type isolate of Edyuillia athecia. The concordance of the trees and high statistical support show that Edyuillia is a synonym of Eurotium. E. tonophilum is known in this study only from the type isolate. Although these three species form a strongly supported branch the branching order is not resolved.
The E. amstelodami lineage includes three isolates that originated from human infections (NRRL 108 an ex type isolate of E. montevidense, NRRL 35696 and NRRL 35697), an ex type isolate of E. heterocaryoticum (Christensen et al 1965) and an isolate of A. hollandicus (anamorph of E. amstelodami). The three isolates with medical origins do not form a separate species under concordance criteria, nor are E. montevidense or E. heterocaryoticum distinct from E. amstelodami. Because E. amstelodami was described first E. heterocaryoticum and E. montevidense are synonyms of E. amstelodami.
Three isolates of E. intermedium and one isolate of A. equitis form the E. intermedium lineage. Eurotium chevalieri along with E. cristatum form a sibling clade to E. amstelodami and E. intermedium. E. cristatum is well supported as a distinct lineage by bs and pp. The relationships of these four species are fully resolved in the tree (FIG. 3).
Eurotium xerophilum is represented by two isolates and E. leucocarpum is represented only by the ex type isolate. Congruence and very high statistical support at all loci demonstrate that these are distinct lineages.
The sibling group of the Eurotium clade contains E. halophilicum and the species Raper and Fennell (1965) assigned to their "A. restrictus group". A single locus (ID) places E. halophilicum with the other Eurotium species with 73% bs support while the BT2, CF and RPB2 loci place E. halophilicum with the anamorphic species from section Restricti but with insignificant statistical support. The current dataset does not satisfactorily resolve the position of E. halophilicum. High bs and pp values and concordance show that A. restrictus, A. caesiellus, A. conicus, A. vitricola, A. penicillioides, A. gracilis and "A. restrictus" NRRL 145 (FIG. 2) are distinct lineages. The four isolates of A. restrictus are polymorphic at each protein coding locus but there is no concordance of the loci nor is there statistical support for any substructure in the lineage.
Sections Fumigati, Cervini and Clavati and Neosartorya, Neocarpenteles and Dichotomomyces (FIG. 4).— –
The A. fumigatus lineage include the ex type of A. fumigatus (NRRL 163), A. phialisepticus (NRRL 6113), A. fumigatus var. acolumnaris (NRRL 5587) and A. anomolus (NRRL 5517), and the lineage is supported by concordance, bs and pp statistics. Three isolates sometimes placed in A. fumigatus, including A. fumigatus var. ellipticus (NRRL 5109) and "A. fumigatus" (NRRL 164 and NRRL 165), form a lineage with 100% bs and pp support in the CF locus and with nondiscordant patterns at the other loci. Using the Dettman et al (2003a) definition of lineages A. fumigatus var. ellipticus is supported as a species. The other four isolates examined here form the A. fumigatus lineage. A. phialisepticus, A. fumigatus var. acolumnaris and A. anomolus are synonyms of A. fumigatus because of priority.
The sibling species of A. fumigatus is the Neosartorya fischeri lineage. Ancestral to both species are A. lentulus, N. spinosa, N. laciniosa, N. aureola and A. viridinutans. Concordance of trees from each locus and statistical support demonstrate these lineages. Among the isolates of N. spinosa are two lineages, one corresponding to the type isolate and another composed of NRRL 185 and NRRL 3435. The latter lineage is strongly supported statistically at the CF locus and the other loci are nondiscordant.
N. quadricincta, A. duricaulis and A. brevipes form a strongly supported branch with each species supported by statistics and concordance. Among the N. quadricincta isolates NRRL 4175 is a distinct lineage both by concordance and statistics. N. pseudofischeri, N. tatenoi and N. spathulata are distinct lineages. Most of the isolates of N. pseudofischeri are similar and form a lineage. However NRRL 1283 differs significantly from other isolates of N. pseudofischeri and by concordance and statistical support is a distinct lineage.
Neosartorya glabra is represented by six isolates in this study. The type isolate and two others form a lineage, but each of the other three isolates is a distinct lineage on the basis of concordance.
Neosartorya fennelliae is represented by five isolates that form a lineage. Sibling to N. fennelliae is N. otanii. The N. otanii isolates were identified tentatively as such by BT2 sequences identical to the published sequence from the type isolates (Takada et al 2001, GB# AB201363
[GenBank]
). The loci show discordant patterns among these five isolates, relegating them to a single lineage. The isolates of N. otanii used here are tentatively identified, so N. otanii cannot be considered a synonym of N. fennelliae until the ex type isolates also are examined. The relationships of the Neosartorya species are not fully resolved by the current data. A number of additional newly described species have not been included here (Horie et al 1995, Horie et al 2001, Hong et al 2005, Hong et al 2006).
The sibling section of Fumigati is composed of section Clavati and species of Dichotomomyces. Aspergillus clavatus is a widespread and variable species well supported by concordance and statistics (FIG. 4). Included in the lineage is NRRL 5811 ex type isolate of A. pallidus that is distinguished from A. clavatus on the basis of white coloration. Because it is part of the A. clavatus lineage it is a synonym of A. clavatus. Neocarpenteles acanthosporus shares a most recent common ancestor with A. clavatus but is a distinct lineage by concordance and statistics. The other species in section Clavati include A. giganteus, A. longavesica, A. clavatonanicus, A. rhizopodus and one undescribed species (FIG. 4). Isolates of Dichotomomyces cejpii form a sibling group of N. acanthosporus and section Clavati. Dichotomomyces, which has an anamorphic state in Polypaecillum, is a monophyletic group distinct from Neocarpenteles.
The section Cervini branch contains the four species placed in the group by Raper and Fennell (1965) and two additional lineages. Full congruence of trees based on the separate loci and strong statistical support recognize the six lineages. Isolates phenotypically identified as A. kanagawaensis and as A. nutans each split into two separate lineages.
Section Cremei and Chaetosartorya species (FIG. 5).— –
The three C. stromatoides isolates form a lineage with strong bs and pp support. The type strain of A. stromatoides is distinct from C. stromatoides and is not its anamorph (Peterson 1995). A. stromatoides should be given a new name. A. itaconicus and A. gorakhpurensis are most closely related to C. stromatoides, and the branching of these two species is statistically supported. The C. cremea lineage is distinct by concordance and statistics. Other lineages in the section are C. chrysella, A. wentii, A. dimorphicus, A. pulvinus and A. flaschentraegeri. While other studies (Peterson 1995) found A. dimorphicus to be a synonym of A. wentii, the additional data used here show that it is a distinct species. A. brunneouniseriatus occurs with the section Cremei isolates but there is only slight statistical support for this arrangement (FIG. 5).
Section Nigri (FIG. 6).— –
As noted above only CF, ID and RPB2 loci were used in congruence analysis of section Nigri. Seven lineages are present among the biseriate species in the section. The A. niger lineage identified by concordance and statistics includes the ex type isolate of A. foetidus. The latter species is a synonym of A. niger. Other lineages within A. niger are nullified by discordance with strong statistical support. Putative isolates of A. tubingensis form two lineages; one contains the type isolate of A. tubingensis and the other an isolate of A. foetidus var. acidus. The distinction of NRRL 4750 is strongly supported statistically and not contradicted by congruence. The four A. carbonarius isolates form a lineage with concordance and statistical support. The sibling species A. ibericus forms a distinct lineage. Aspergillus heteromorphus and A. ellipticus are represented only by the ex type isolates.
Isolates of the uniseriate species A. japonicus and A. aculeatus form a strongly supported branch associated with the biseriate species of the section (FIGS. 1, 6). A third uniseriate species A. homomorphus (Samson et al 2005) was not included here but appears to be distinct from isolates examined here on the basis of the BT2 sequence. The four A. japonicus isolates examined form a single lineage with concordance and statistical support. The four putative A. aculeatus isolates show patterns of congruence and strong bs support for three lineages. Several recently described species (Samson et al 2005) have not been included in this study. The BT2 sequences of A. lacticoffeatus is identical to the sequence from A. niger ex type. The species A. vadensis, A. piperis and A. costaricaensis have BT2 sequences distinct from the ex type culture of A. tubingensis but were not included in this study.
Section Sparsi (FIG. 7).— –
Eight lineages are in section Sparsi. Aspergillus panamensis was placed the A. wentii group (Thom and Raper 1945) or the A. ustus group (Raper and Fennell 1965). A. anthodesmis was placed in the A. wentii group (Samson 1979). A. conjunctus was placed in A. nidulans group (Raper and Fennell 1965). Phylogenetic analysis of the BT2, CF and RPB2 loci splits the four A. sparsus isolates into sibling species, two isolates from Central America comprising A. sparsusT (NRRL 1933) and two isolates originating in Haiti representing an undescribed species. Aspergillus diversus and A. biplanus are sibling taxa that are supported in 95–100% of the bs samples of the BT, CF and RPB2 loci, the ID locus being congruent but with nonsignificant bs support. A. funiculosus is the only uniseriate species in the section.
Section Flavi and Petromyces species (FIG. 8).— –
Twelve lineages were observed in section Flavi. The A. flavus lineage included the ex type cultures of A. oryzae, A. flavus v. columnaris and A. thomii. One species often held to be synonymous with A. flavus, A. subolivaceus, was supported as a separate lineage by two loci with high bs and pp statistics. The A. parasiticus lineage included the type strain of A. terricola var. americana and an isolate of A. sojae. The A. tamarii lineage included the type isolates of A. flavofurcatis and A. terricola. The A. nomius isolates formed two lineages with statistical support and the concordance of two loci. The Petromyces alliaceus clade contained the type isolate and three others. The ex type isolate of P. albertensis and NRRL 317 are strongly supported as a lineage by the BT2 locus (86% bs, 1.00 pp). The other loci do not distinguish the lineage but are not discordant. Aspergillus lanosus lineage contains the type isolate (from India) and NRRL 5108 isolated in Argentina. BT2 and CF loci show these isolates as a statistically supported lineage, ID is nondiscordant and RPB2 has statistical support for each isolate being a distinct lineage. The A. coremiiformis lineage is moderately well supported (84% bs) as sibling taxon of the Petromyces branch. A. caelatus, A. pseudotamarii and A. bombycis are strongly supported lineages. A. leporis and A. avenaceus are well separated from other species but belong in the section (FIG. 2).
Section Circumdati and Neopetromyces species (FIG. 9).— –
Twenty-two lineages were identified in section Circumdati. This treatment differs from the single locus study of Frisvad et al (2004) primarily in identifying additional species. Some of the isolates identified by Raper and Fennell (1965) as A. petrakii form a lineage, but because the type isolate of A. petrakii is in the A. ochraceus lineage the species is invalid under the rules of the ICBN. These isolates (NRRL 4748 and NRRL 4789) form an unnamed lineage. Two isolates (NRRL 6161 and NRRL 5170) form a lineage. NRRL 6161 was considered to be the type strain of A. fresenii, so the species can be returned to usage. Also two isolates resembling A. sclerotiorum (NRRL 35028 and NRRL 35056) form a lineage by concordance and statistical support. Other lineages (FIG. 9) are supported by majority rule concordance and/or strong statistical support.
Sections Terrei, Flavipes, Versicolores (in part) and Fennellia species (FIG. 10).— –
Six lineages were observed among isolates that fit into Raper’s and Fennell’s (1965) concept of section Terrei. The A. terreus var. africanus lineage is supported by concordance of trees and statistics as distinct from the A. terreus lineage. Two additional isolates of "A. terreus", NRRL 1913 and NRRL 260 form an unnamed lineage closely related to the prior two species. Single-isolate lineages found in the section are represented by NRRL 4017, NRRL 28910 and A. terreus var. aureus NRRL 1923. The taxonomic changes will be published elsewhere. Also included in section Terrei are four species typically placed in section Flavipedes and two species from section Versicolores. Four isolates including the type isolate of "A. niveus" constitute a lineage by concordance and statistics. Fennellia nivea, the hypothesized teleomorph is not related to "A. niveus" and thus this species must be renamed. Closely related to "A. niveus" is A. carneus. Two isolates of A. allahabadii constitute a lineage on the basis of concordance and statistical support. A. niveus var. indicus is a single-isolate lineage clearly distinguished from "A. niveus" and from F. nivea. It will be raised to species rank in a separate publication. Also included in this section (FIGS. 2, 10) are the species A. ambiguus and A. microcysticus, originally placed in section Versicolores.
In a sibling branch are species previously assigned to sections Flavipedes and Usti. Three isolates identified as A. flavipes form a lineage that is sibling of F. flavipes. However the A. flavipes lineage does not include the type isolate of that species and so must be given a new name. The A. iizukae lineage is represented by the type isolate and NRRL 35046. The type isolate of A. flavipes NRRL 302 represents another lineage but because it is not part of the F. flavipes lineage must be renamed. Three additional single-isolate lineages are recognized, A. aureofulgens, represented by the type isolate NRRL 6326, "A. carneus" NRRL 4610, and "A. aureofulgens" NRRL 32683. A. janus and A. janus var. brevis are strongly supported by concordance and statistics to represent distinct lineages. To reflect that fact the variety is raised to species rank as A. brevijanus.
Aspergillus brevijanus comb. nov. (Raper and Fennell) S.W. Peterson
Basionym: Aspergillus janus variety brevis.
Mycologia 36:561. 1944.
Section Candidi includes the two species A. candidus and A. campestris (Peterson 2000) and is included in FIG. 10 merely for convenience. From the initial survey of five putative A. candidus isolates, two additional lineages have been recognized. Section Candidi is part of a strongly supported clade in the Aspergillus isolates (FIG. 2) and additional studies are needed to understand its diversity.
Sections Nidulantes, and Ochraceorosei and other species (FIG. 11).— –
Section Nidulantes includes 27 lineages that are supported by concordance of the trees and statistics. The E. quadrilineata lineage includes the ex type isolates of E. parvathecia and E. acristata. Emericella variecolor isolates as identified by Raper and Fennell (1965) represent two separate lineages. Among isolates previously identified as A. versicolor are lineages centered on the type isolates of A. tabacinus and A. protuberus and an undescribed lineage that includes NRRL 227. A. versicolor and A. sydowii isolates form a monophyletic section Versicolores, but no other species assigned to section Versicolores can be put in a monophyletic group with the type of the section, A. versicolor. Accordingly the section could be dropped with little loss. A. aeneus isolates represent two separate sibling lineages. Aspergillus raperi and A. ivoriensis form a monophyletic group, and while they could be placed in section Nidulantes are sufficiently different that they were once placed in section Ornati (Samson 1979). A. bisporus isolates also form a monophyletic group and they previously were placed in section Cervini (Samson 1979). Monophyly and phenotype suggest that new sections be erected for these species.
Section Usti.— –
Section Usti (FIG. 12) includes 15 lineages. A. ustus and A. puniceus previously were placed in section Usti while the other species have been placed mostly in Versicolores or Nidulantes. A single species of Emericella, E. heterothallica belongs in section Usti with all other Emericella species in section Nidulantes. A. amylovorous is synonymous with the subsequently named A. cavernicola. Samson (1979) placed A. amylovorous, A. cavernicola, A. elongatus, A. lucknowensis and A. pseudodeflectus in the A. versicolor group and A. kassunensis and A. egyptiacus in the A. nidulans group. Raper and Fennell (1965) placed A. granulosus in the A. versicolor group and E. heterothallica and A. subsessilis in the A. nidulans group. All of these species fit into a monophyletic section Usti.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
) or the number of species in Neurospora (Dettman et al 2003b). Analytical techniques are available to address the broad question of how all fungi are related and also the very narrow question of where species boundaries occur (Baum and Shaw 1995, Taylor et al 2000, Sites and Marshall 2003). The issue of what constitutes a species continues to be debated (e.g. Rieppel 2007), but the phylogenetic species concept with recognition by concordance of independent gene trees is a very attractive option. Because these species are defined in terms of genetics, monophyly can be assured. An additional benefit of genetically defined species is that they are readily amenable to rapid detection techniques that identify species through polymorphisms in DNA (Perrone et al 2006, Page and Kurtzman 2005).
Interpreting the species.— –
Dettman et al (2003a, b, 2006) described phylogenetic species recognition through concordance of phylogenetic trees from unlinked loci. This is the approach used in interpreting these data. Branches are categorized as fully congruent when a single group of isolates always occurs as a terminal group and there is strong statistical support for that grouping, either by bootstrap analysis or Bayesian posterior probability analysis. Branches are categorized as noncontradictory when one locus produces a grouping of isolates that contradicts another locus but does so without significant statistical support. Branches are categorized as contradictory when there is strong statistical support for grouping the isolates differently based on the locus used to analyze them. Given recombination one expects alleles from unlinked loci to recombine producing different allelic patterns and thus in phylogenetic analysis to produce incongruent tree diagrams among isolates of a species. Multiple isolates of each species were examined where possible, but the approach has been limited by several species that are known only from the type isolate and the finding that many assumed species are actually composed of several species, which reduced the number of isolates representing each species.
Having a stable and nonmorphological means of identifying species has been especially helpful in medical mycology where there is occasional uncertainty about the identity of isolates causing various human infections (Padhey et al 1995, Lonial et al 1997, Guarro et al 2002, Jarv et al 2004, Balajee et al 2005a, b) and where the need for defined species boundaries is clear (Hinrikson et al 2005).
When the Fennellia species were discovered and described (Wiley and Fennell 1973, Wiley and Simmons 1973) there was no simple way to connect anamorphic and teleomorphic states other than seeing them in the same culture. The anamorphs of F. nivea and F. flavipes were similar to the existing species A. niveus and A. flavipes and the connection was postulated. The concordance analysis disproves the hypothesis with strong statistical support. The usefulness of concordance for hypothesis testing in Aspergillus provides a powerful analytical tool for decision making in taxonomy.
Distinguishing single-isolate species.— –
In several of the Aspergillus sectional tree diagrams single-isolate species occur as siblings (e.g. FIG. 3. section Restricti; FIG. 4 A. duricaulis and A. brevipes; FIG. 5 A. itaconicus and A. gorakhpurensis). Invoking genetic distance as the basis for distinguishing species is unreasonable because species occur in different sized measures of time and space (Reippel 2007). Dettman et al (2003b) consider genetic differentiation as necessary for a species. The branching to A. itaconicus has support of 63% bs and 1.00 pp (FIG. 5), while the branching to A. gorakhpurensis has support of 94% bs and 1.00 pp and the branch to A. stromatoides has support values of 100% bs and 1.00 pp. Strong statistical support derived from phylogenetically informative data along with the branch being present in each of the single locus trees is taken as support for the isolate representing a distinct species. Samson et al (2004) applied morphological, physiological and extrolite data to single locus DNA data in revising Penicillium subgenus Penicillium. That approach does much to enhance our knowledge of biodiversity and characteristics of fungi but does not directly address the issue of species versus individuals in the species.
Beta tubulin genes.— –
Beta tubulin is found at two loci in several of the Aspergillus species that have been sequenced. A. fumigatus has beta tubulin at GenBank No. AFUA_7G00250 and GenBank No. A-FUA_1G10910; N. fischeri at GenBank No. N-FIA_112720 and GenBank No. NFIA_014730; A. clavatus at GenBank No. ACLA_046030 and Gen-Bank No. ACLA_024600 and A. nidulans has the benA (GenBank No. M17519
[GenBank]
) and tubC (GenBank No. M17520
[GenBank]
) loci. The genes are structurally different in regard to intron number and position. Paralogy is one possible explanation for the difference in intron number and the strong discordance of trees from different loci observed in section Nigri (FIGS. 1, 6). It is puzzling that among the sibling species A. japonicus and A. aculeatus, different forms of beta tubulin were amplified by primers that have demonstrated specificity in a broad diversity of fungi (Glass and Donaldson 1995). On the other hand one could hypothesize horizontal transfer between species or an internal rearrangement of the gene involving intron loss or gain (Logsdon 2004). Significantly more information is needed to explain these results, but because of the strong discordance, beta tubulin was not used for analysis of groups where the physical structure of the amplified fragment differed.
Sections and subgenera.— –
The last general revision of subgeneric taxonomy for Aspergillus was proposed by Gams et al (1985), in which the genus was divided into 18 sections organized in six subgenera. Species from Eurotium and the A. restrictus group were placed in subgenus Aspergillus. This disposition is strongly supported by phylogenetic analysis and the statistical support for the subgenus is strong. Gams et al (1985) also placed sections Fumigati and Cervini in subgenus Fumigati and section Clavati in subgenus Clavati. The principal of monophyly (FIG. 2) shows that sections Clavati and Fumigati could be placed in a single subgenus, either with section Cervini also in the subgenus or in a distinct subgenus. It seems reasonable to place all three sections in subgenus Fumigati and no longer use subgenus Clavati because it is superfluous. Section Ornati in subgenus Ornati is fully in agreement with the phylogenetic analysis. However section Ornati is reduced to include only the species with teleomorphs in Sclerocleista and the other species from the section are in phylogenetically distinct groups. Subgenus Circumdati (Gams et al 1985) contains sections Circumdati, Candidi, Cremei, Flavi, Nigri, Sparsi and Wentii. Phylogenetically a monophyletic subgenus Circumdati contains sections Circumdati, Candidi, Cremei, Flavi, Flavipedes, Nigri and Terrei. Section Wentii was regarded as superfluous by Peterson (1995) and this study is in agreement. Subgenus Nidulantes contains sections Nidulantes, Flavipedes, Terrei, Usti and Versicolores (Gams et al 1985). Phylogenetically the subgenus contains section Nidulantes, Ochraceorosei (Frisvad et al 2005), Usti and Sparsi. Section Versicolores as envisioned by Gams et al (1985) contains species that are phylogenetically members of other sections and subgenera. A monophyletic section Versicolores contains only A. versicolor and A. sydowii, and those two species are accommodated easily in section Nidulantes. On this basis section Versicolores is superfluous and its use should cease.
There are some species whose disposition in a monophyletic taxonomy is not so clear. Aspergillus raperi and A. ivoriensis form a monophyletic group that could be included in section Nidulantes (FIG. 11) or could be described as a distinct section. A. bisporus is monophyletic and similarly could be described as a section. A. silvaticus is a distinct species whose monophyletic placement would indicate the need for a section to accommodate it. These hypothetical sections would be placed in subgenus Nidulantes.
Aspergillus malodoratus, A. crystallinus and Hemicarpenteles paradoxa are phylogenetically part of the Eupenicillium lineage of Penicillium. Raper and Fennell (1965) noted that A. crystallinus and A. malodoratus have a stage where the conidiogenous cells resemble Penicillium species. Phylogenetically they belong in Penicillium and the formal name change will be made elsewhere. Aspergillus clavatoflavus, A. zonatus and Warcupiella spinulosa form separate monophyletic groups (FIG. 2) and separate sections could be erected to accommodate these species. However further detailed study is needed to resolve the relationships of these species to Hamigera and Monascus species and make necessary taxonomic changes.
Aspergillus groups (Thom and Church 1926, Thom and Raper 1945, Raper and Fennell 1965) have been taxonomic aids that have changed regularly as the collection and interpretation of data became more and more complete. It is only since 1985 (Gams et al 1985) that the groups have had status in the taxonomic hierarchy as sections. The limited resolution of species and section (FIG. 2) suggests (Rokas and Carroll 2005) that additional genes be sequenced to arrive at a fully resolved tree.
It would be possible to change the taxonomy of Aspergillus splitting the form genus into a number of genera based on the teleomorphic states associated with particular monophyletic groups. The retention of Aspergillus as a genus reflects a monophyletic arrangement. Aspergillus in the broad sense includes some species that have teleomorphs and other species that display only the anamorphic state. Keeping Aspergillus as a monophyletic genus reflects the actual relationships of species displaying an aspergillum whereas dividing the form genus into several genera based on teleomorphs would deemphasize the relationships for most biologists not intimately familiar with the genus. For this reason and the logical difficulty of describing Aspergillus species as, for instance Eurotium species when they lack the Eurotium state, the larger form genus Aspergillus is retained.
Eupenicillium species are a monophyletic group within the larger monophyletic group that includes Aspergillus species (FIG. 2), while the Penicillium species that have Talaromyces teleomorphs or are placed in subgenus Biverticillatum form groups outside of the Aspergillus branch. The phylogenetic distinction between subgenus Biverticillatum and the Eupenicillium related species is well documented (Berbee et al 1995) but the relationship of Eupenicillium and Aspergillus species has not been supported by sufficient statistical support to resolve it. Morphologically both Aspergillus species and Eupenicillium species have ampuliform conidiogenous cells (phialides) while those in subgenus Biverticillium are acerose with collula tapering to fine apical openings, a distinction on which Pitt (1980) was able to key species into subgenera.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Corresponding author. E-mail: stephen.peterson{at}ars.usda.gov
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
———, ———, Hanley D, Nickle D, Marr KA. 2005b. Aspergillus lentulus sp. nov., a new sibling species of A. fumigatus. Eukaryot Cell 4:625–632.
Baum DA, Shaw KL. 1995. Genealogical perspectives on the species problem. In: Hoch PC, Stephenson AG, eds. Experimental and Molecular Approaches to Plant Biosystematics Missouri Botanical Garden. p 289–303.
Berbee ML, Yoshimura A, Sugiyama J, Taylor JW. 1995. Is Penicillium monophyletic? An evaluation of phylogeny in the family Trichocomaceae from 18S, 5.8S and ITS ribosomal DNA sequence data. Mycologia 87:210–222.[CrossRef]
Dettman JR, Jacobson DJ, Taylor JW. 2003a. A multilocus genealogical approach to phylogenetic species recognition in the model eukaryote Neurospora. Evolution 57:2703–2720.[CrossRef][Medline]
———, ———, Turner E, Pringle A, Taylor JW. 2003b. Reproductive isolation and phylogenetic divergence in Neurospora: comparing methods of species recognition in a model Eukaryote. Evolution 57:2721–2741.[CrossRef][Medline]
———, ———, Taylor JW. 2006. Multilocus sequence data reveal extensive phylogenetic species diversity within the Neurospora discreta complex. Mycologia 98:436–446.
Frisvad JC, Frank JM, Houbraken JAMP, Kuijpers AFA, Samson RA. 2004. New ochratoxin A producing species of Aspergillus section Circumdati. Stud Mycol 50:23–43.
———, Samson RA. 2004. Emericella venezuelensis, a new species with stellate ascospores producing sterigmatocystin and aflatoxin B1. Syst Appl Microbiol 27:672–680.[CrossRef][Medline]
———, Skouboe P, Samson RA. 2005. Taxonomic comparison of three different groups of aflatoxin producers and a new efficient producer of aflatoxin B1, sterigmatocystin and 3-O-methylsterigmatocystin, Aspergillus rambelli sp. nov. Syst Appl Microbiol 28:442–453.[CrossRef][Medline]
Galagan JE, Calvo SE, Cuomo C, Ma LJ, Wortman JR, Batzoglou S, Lee SI, Bastörkmen M, Spevak CC, Clutterbuck J, Kapitonov V, Jurka J, Scazzocchio C, Farman M, Butler J, Purcell S, Harris S, Braus GH, Draht O, Busch S, D’Enfert C, Bouchier C, Goldman GH, Bell-Pedersen D, Griffiths-Jones S, Doonan JH, Yu J, Vienken K, Pain A, Freitag M, Selker EU, Archer DB, Peñalva MA, Oakley BR, Momany M, Tanaka T, Kumagai T, Asai K, Machida M, Nierman WC, Denning DW, Caddick M, Hynes M, Paoletti M, Fischer R, Miller B, Dyer P, Sachs MS, Osmani SA, Birren BW. 2005. Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae. Nature 438:1092–1093.[Medline]
Gams W, Christensen M, Onions AHS, Pitt JI, Samson RA. 1985. Infrageneric taxa of Aspergillus. In: Samson RA, Pitt JI, eds. Advances in Aspergillus systematics. New York: Plenum Press. p 55–64.
Geiser DM, Gueidan C, Miadlikowska J, Lutzoni F, Kauff F, Hofstetter V, Fraker E, Schoch CL, Tibell L, Untereiner WA, Aptroot A. 2006. Eurotiomycetes: Eurotiomycetidae and Caetothyriomycetidae. Mycologia 98:1053–1064.
Glass NL, Donaldson G. 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl Environ Microbiol 61:1323–1330.
Guarro J, Kallas EG, Godoy P, Karenina A, Gene J, Stchigel A, Colombo AL. 2002. Cerebral apergillosis caused by Neosartorya hiratsukae, Brazil. Emerging Infect Dis 8:989–991.[Medline]
Hinrikson HP, Hurst SF, Lott TJ, Warnock DW, Morrison CJ. 2005. Assessment of ribosomal large-subunit D1–D2, internal transcribed spacer 1 and internal transcribed spacer 2 regions as targets for molecular identification of medically important Aspergillus species. J Clin Microbiol 43:2092–2103.
Hong S-B, Go S-J, Shin H-D, Frisvad JC, Samson RA. 2005. Polyphasic taxonomy of Aspergillus fumigatus and related species. Mycologia 97:1316–1329.
———, Cho H-S, Shin H-D, Frisvad JC, Samson RA. 2006. Novel Neosartorya species isolated from soil in Korea. Int J Syst Evol Microbiol 56:477–486.
Horie Y, Makoto M, Nishimura K, Franco MF, Coelho KIR. 1995. New and interesting species of Neosartorya from Brazilian soil. Mycoscience 36:199–204.[CrossRef]
———, Abliz P, Fukushina K, Okada K, Gusmao NB. 2001. Neosartorya takakii, a new species from soil in Brazil. Mycoscience 42:91–95.[CrossRef]
Huelsenbeck JP, Ronquist F. 2001. MrBayes: Bayesian inference of phylogeny. Bioinformatics 17:754–755.
Jarv H, Lehtmaa J, Summerbell RC, Hoekstra ES, Samson RA, Naaber P. 2004. Isolation of Neosartorya fischeri from blood: first hint of pulmonary aspergillosis. J Clin Microbiol 42:925–928.
Liu Y, Whelen S, Hall BD. 1999. Phylogenetic relationships among Ascomycetes: evidence from an RNA polymerase II subunit. Mol Biol Evol 16:1799–1808.[Abstract]
LoBuglio KF, Taylor JW. 1993. Molecular phylogeny of Talaromyces and Penicillium species in subgenus Biverticillium. In: Reynolds DR, Taylor JW, eds. The fungal holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics. Surrey, UK: CAB International. p 115–119.
Logsdon JM. 2004. Worm genomes hold the smoking guns of intron gain. Proc Nat Acad Sci (USA) 101:11195–11196.
Lonial S, Williams L, Carrum G, Ostrowski M, McCarthy P. 1997. Neosartorya fischeri: an invasive fungal pathogen in an allogeneic bone marrow transplant patient. Bone Marrow Transplant 19:753–755.[CrossRef][Medline]
Ogawa H, Yoshimura A, Sugiyama J. 1997. Polyphyletic origins of species of the anamorphic genus Geosmithia and the relationships of the cleistothecial genera: evidence from 18S, 5S and 28S rDNA sequence analysis. Mycologia 89:756–771.[CrossRef]
Padhye AA, Godfrey JH, Chandler FW, Peterson SW. 1995. Osteomyelitis caused by Neosartorya pseudofischeri. J Clin Microbiol 32:2832–2836.
Page BT, Kurtzman CP. 2005. Rapid identification of Candida species and other clinically important yeast species by flow cytometry. J Clin Microbiol 43:4507–4514.
Perrone G, Mulè G, Susca A, Battilani P, Pietri A, Logrieco A. 2006. Ochratoxin A production and amplified fragment length polymorphism analysis of Aspergillus carbonarius, Aspergillus tubingensis and Aspergillus niger strains isolated from grapes in Italy. Appl Environ Microbiol 72:680–685.
Peterson SW. 1995. Phylogenetic analysis of Aspergillus sections Cremei and Wentii, based on ribosomal DNA sequences. Mycol Res 99:1349–1355.[CrossRef]
———. 2000. Phylogenetic relationships in Aspergillus based upon rDNA sequence analysis. In: Samson RA, Pitt JI, eds. Classification of Penicillium and Aspergillus: integration of modern taxonomic methods. Reading, UK: Harwood Publishers. p 323–356.
Pitt JI. 1980. The genus Penicillium and its teleomorphic states Eupenicillium and Talaromyces. New York: Academic Press.
Raper KB, Fennell DI. 1965. The genus Aspergillus. Baltimore: Williams & Wilkins Co.
Rieppel O. 2007. Species: kinds of individuals or individuals of a kind. Cladistics 23:373–384.[CrossRef]
Rokas A, Carroll SB. 2005. More genes or more taxa? The relative contribution of gene number and taxon number to phylogenetic accuracy. Mol Biol Evol 22:1337–1344.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574.
Samson RA. 1979. A compilation of the Aspergilli described since 1965. Stud Mycol 18:1–38.
———, Seifert KA, Kuijper AFA, Houbraken JAMP, Frisvad JC. 2004. Phylogenetic analysis of Penicillium subgenus Penicillium using partial β-tubulin sequences. Stud Mycol 49:175–200.
———, Houbraken JAMP, Kuijpers AFA, Frank JM, Frisvad JC. 2005. New ochratoxin A or sclerotium producing species in Aspergillus section Nigri. Stud Mycol 50:45–61.[Medline]
Serra R, Cabanes FJ, Perrone G, Castella G, Venancio A, Mule G, Kozakiewicz Z. 2006. Aspergillus ibericus: a new species of section Nigri isolated from grapes. Mycologia 98:295–306.
———, Peterson SW. 2007. Penicillium astrolabium and Penicillium neocrassum, two new species isolated from grapes and their phylogenetic placement in the P. olsonii and P. brevicompactum clade. Mycologia 99:78–87.
Sites JW, Marshall JC. 2003. Delimiting species: a renaissance issue in systematic biology. Trend Ecol Evol 18:462–470.[CrossRef]
Swofford DL. 2003. PAUP*: phylogenetic analysis using parsimony (*and other methods). Version 4. Sunderland, Massachusetts: Sinauer Associates.
Takada M, Horie Y, Abliz P. 2001. Two new heterothallic Neosartorya from African soil. Mycoscience 42:361–367.[CrossRef]
Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, Fisher MC. 2000. Phylogenetic species recognition and species concepts in fungi. Fung Genet Biol 31:21–32.[CrossRef]
Thom C, Church MB. 1926. The Aspergilli. Baltimore: Williams & Wilkins Co.
———, Raper KB. 1945. Manual of the Aspergilli. Baltimore: Williams & Wilkins Co.
Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal V: improving the sensitivity of progressive multiple sequence alignments through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acid Res 22:4673–4680.
Varga J, Tóth B, Kocsubó S, Farkas B, Szakács G, Téren J, Kozakiewicz Z. 2005. Evolutionary relationships among Aspergillus terreus isolates and their relatives. Antonie von Leeuwenhoek 88:141–150.[CrossRef][Medline]
Wiley BJ, Simmons EG. 1973. New species and a new genus of Plectomycetes with Aspergillus states. Mycologia 65:934–938.[CrossRef]
———, Fennell DI. 1973. Ascocarps of Aspergillus stromatoides, A. niveus and A. flavipes. Mycologia 65:752–760.[CrossRef]
This article has been cited by other articles:
 |
|
 |
|
  G. Butler Fungal Sex and Pathogenesis Clin. Microbiol. Rev., January 1, 2010; 23(1): 140 - 159. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Etienne, L. Gade, S. R. Lockhart, D. J. Diekema, S. A. Messer, M. A. Pfaller, and S. A. Balajee Screening of a Large Global Aspergillus fumigatus Species Complex Collection by Using a Species-Specific Microsphere-Based Luminex Assay J. Clin. Microbiol., December 1, 2009; 47(12): 4171 - 4172. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Sutton, B. L. Wickes, A. M. Romanelli, M. G. Rinaldi, E. H. Thompson, A. W. Fothergill, M. K. Dishop, O. Elidemir, G. B. Mallory, S. P. Moonnamakal, et al. Cerebral Aspergillosis Caused by Aspergillus granulosus J. Clin. Microbiol., October 1, 2009; 47(10): 3386 - 3390. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. Staab, S. A. Balajee, and K. A. Marr Aspergillus Section Fumigati Typing by PCR-Restriction Fragment Polymorphism J. Clin. Microbiol., July 1, 2009; 47(7): 2079 - 2083. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. W. Horn, G. G. Moore, and I. Carbone Sexual reproduction in Aspergillus flavus Mycologia, May 1, 2009; 101(3): 423 - 429. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Peterson Aspergillus brevijanus Mycologia, May 1, 2009; 101(3): 430 - 430. [Full Text] [PDF]
|
|
|
|
|
|
B. W. Horn, J. H. Ramirez-Prado, and I. Carbone The sexual state of Aspergillus parasiticus Mycologia, March 1, 2009; 101(2): 275 - 280. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
