| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Biological Sciences, Idaho State University, Pocatello, Idaho 83209
Christopher A. Pearl
USGS Forest and Rangeland Ecosystem Science Center, 3200 SW Jefferson Way, Corvallis, Oregon 97331
David S. Pilliod 2
Aldo Leopold Wilderness Research Institute, USDA Forest Service Rocky Mountain Research Station, Missoula, Montana 59801
Peter P. Sheridan
Charles F. Williams
Charles R. Peterson
Department of Biological Sciences, Idaho State University, Pocatello, Idaho 83209
R. Bruce Bury
USGS Forest and Rangeland Ecosystem Science Center, 3200 SW Jefferson Way, Corvallis Oregon 97331
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
We assessed the diversity and phylogeny of Saprolegniaceae on amphibian eggs from the Pacific Northwest, with particular focus on Saprolegnia ferax, a species implicated in high egg mortality. We identified isolates from eggs of six amphibians with the internal transcribed spacer (ITS) and 5.8S gene regions and BLAST of the GenBank database. We identified 68 sequences as Saprolegniaceae and 43 sequences as true fungi from at least nine genera. Our phylogenetic analysis of the Saprolegniaceae included isolates within the genera Saprolegnia, Achlya and Leptolegnia. Our phylogeny grouped S. semihypogyna with Achlya rather than with the Saprolegnia reference sequences. We found only one isolate that grouped closely with S. ferax, and this came from a hatchery-raised salmon (Idaho) that we sampled opportunistically. We had representatives of 7–12 species and three genera of Saprolegniaceae on our amphibian eggs. Further work on the ecological roles of different species of Saprolegniaceae is needed to clarify their potential importance in amphibian egg mortality and potential links to population declines.
Key words: Achlya, amphibian decline, egg, lake, Leptolegnia, oomycete, Saprolegnia ferax, S. semihypogyna
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). These organisms often are referred to as oomycetes or "water molds" and can be found on decaying animal and plant debris in freshwater habitats worldwide. They can occur on adult fish and on the eggs of fish and amphibians (Hoffman 1967, Czeczuga et al 1998). The family Saprolegniaceae has 19 genera and roughly 150 species (Dick 1973).
Identification of Saprolegniaceae traditionally has relied on the observation of morphological features (Seymour 1970, but see Hulvey et al 2007). Genera of the Saprolegniaceae have been differentiated by their method of zoospore release (Seymour 1970, Daugherty et al 1998). Species identification has been more challenging because it has required presence of the sexual structures, the oogonia and antheridia. More recently molecular identification has been accomplished with selected Saprolegniaceae using the internal transcribed spacer (ITS) and 5.8S regions of ribosomal DNA (rDNA) (Molina et al 1995, Leclerc et al 2000). The most complete molecular phylogeny of this family to date identified 10 genera and 40 species through analyses of ITS and the large ribosomal subunit (LSU) (Leclerc et al 2000).
There have been relatively few published field investigations of Saprolegniaceae diversity and ecology. This is particularly true in the Pacific Northwest, USA, which is a region where Saprolegnia has been identified as a potential pathogen on amphibians that have experienced local declines (Kiesecker and Blaustein 1995). For example Blaustein et al (1994) suggested Saprolegnia ferax was responsible for mortality of nearly 95% of western toad (Bufo boreas) eggs at one site in Oregon. Despite these claims that S. ferax is a pathogenic water mold of amphibian eggs, no studies have attempted to document which species of oomycetes occur on the eggs of North American amphibians and whether egg mortality is uniquely associated with S. ferax.
As a result of concern over observed amphibian egg mortality and the difficulty of identifying taxa microscopically, we sought to identify oomycetes cultured from amphibian eggs from around the Pacific Northwest with ITS and 5.8S rRNA gene sequences. We compared sequences of Saprolegniaceae cultured from amphibian eggs to reference cultures from the American Type Culture Collection (ATCC) and published sequences from GenBank. The information from this survey should be of value to mycologists and amphibian biologists who are interested in the distribution of oomycetes and their ecological relationships with amphibians.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). We coded sample numbers based on physiographic provinces: IS = Snake River Plain in southern Idaho; IM = Bitterroot Mountains of Idaho and western Montana; OE = Blue Mountains of eastern Oregon; OW = Cascade Range and Willamette Basin of western Oregon; WA = Cascade Range around Mount Rainier, Washington (FIG. 1). The six amphibians included the long-toed salamander (Ambystoma macrodactylum), Pacific tree frog (Pseudacris regilla), northern red-legged frog (Rana aurora), Cascades frog (R. cascadae), Columbia spotted frog (R. luteiventris) and Oregon spotted frog (R. pretiosa). For all sampled amphibian egg masses, we collected equivalent numbers of healthy eggs and eggs that appeared diseased (with white or gray hyphal nimbus, FIG. 2) in sterile 2 oz. polypropylene containers filled with surrounding pond water. Because several Saprolegnia species first were isolated from salmonids, we opportunistically collected three samples from fish in southern Idaho: rainbow trout (Oncorhynchus mykiss) eggs from a hatchery and scale scrapings from a dead rainbow trout (O. mykiss) and a hatchery-raised Chinook salmon (O. tshawytscha).
|
|
|
, Green 1999). We did not exclude any filamentous microorganisms in the culturing process so we used a nonselective media, potato-dextrose agar (PDA). PDA plates were made from 24 g of potato dextrose (Difco) and 15 g of agar (Difco) per L. We used a sterile pipette to transfer 1–2 amphibian eggs from each sample to a PDA plate. We used sterile forceps to place fish eggs and skin scrapings on PDA plates. We incubated cultures at 22 C for 24 h or until the growth of filamentous organisms was evident. To obtain a pure culture of the filamentous organism we used a sterile hypodermic needle to transfer a small amount of the cultured filamentous growth to a second PDA plate which we incubated at 22 C for 24 h. In the majority of cultures (75%) filamentous growth occurred quickly and was able to outgrow any bacteria in the culture. In cases where the filamentous growth was slower bacteria were evident on the original PDA plate. When bacteria and filamentous growth were present together in culture, successive hyphal transfers were used to obtain a pure filamentous culture. We obtained three Saprolegniaceae isolates from the ATCC (10801 University Blvd., Manassas, Virginia 20110-2209 USA): Saprolegnia ferax (Gruithuisen) Thuret (ATCC 26116), Saprolegnia parasitica Coker (ATCC 22284) and Achlya americana Humphrey (ATCC 22599). We cultured and sequenced the ATCC isolates in the same manner as the egg and fish samples.
DNA extraction, PCR amplification, and sequencing.— –
We extracted DNA from each filamentous organism using a procedure adapted from Griffith and Shaw (1998) for DNA isolation from Phytophthora infestans. This process uses a modified extraction buffer (100 mM Tris-HCL, 1.4 M NaCl, 2% CTAB and 20 mM EDTA sodium salt pH 8.0) and a chloroform extraction technique. Precipitation of DNA was completed with isopropanol and centrifugation at 17 000 x g. We confirmed the DNA was intact by running each sample on 1.2% agarose gels. Samples were stored at 4 C until use in the polymerase chain reaction (PCR).
The ITS1 and ITS2 regions and the intermediate 5.8S ribosomal gene were amplified using the primers ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3') (White et al 1990) in a 50 nmole concentration (HPLC purified) from Operon (QIAGEN). We performed PCR reactions in a 50 µL volume using the HotStarTaq Master Mix Kit (QIAGEN) and a final 1 µM concentration of each primer. The final template DNA concentration used for each reaction was 10 ng/µL. We performed PCR amplifications with an Applied Biosystems 2400 thermocycler (Applied Biosystems). The PCR temperature profile was an initial activation at 95 C for 15 min followed by 30 cycles with target temperatures at 94 C, 54 C and 72 C each for 1 min. A final extension at 72 C for 10 min completed the run. We analyzed PCR products by electrophoresis on 1.2% agarose gels and stained the gels with ethidium bromide (50 µg/µL) to confirm the presence of the PCR product. PCR products were directly purified with the MinElute PCR Purification Kit (QIAGEN) for sequencing. Purified PCR products were sequenced with big dye terminator primers in the 3100 Genetic Analyzer (Applied Biosystems) at the Molecular Core Facility at Idaho State University at Pocatello.
Alignment and phylogenetic analysis.— –
We used PHRED (Ewing et al 1998a) to assess the quality of DNA base call sequences. We considered 111 sequences to be of excellent quality to be used for further analysis. We used PHRAP (PHRED II, Ewing et al 1998b) to build a consensus sequence from forward and reverse sequences identified by PHRED.
Quality sequences were identified by BLAST (Basic Local Alignment Search Tool, Altschul et al 1990) using the National Center for Biotechnology Information (NCBI) BLAST feature (http://www.ncbi.nlm.nih.gov/BLAST). We used the nucleotide-nucleotide search option, which uses a heuristic algorithm to search for sequence homology (Altschul et al 1990).
To see the phylogenetic relationships among our Saprolegniaceae sequences, we used Geneious Pro® (version 2.5.2) to produce a multiple global alignment of 88 sequences. The sequences in our phylogeny included: (i) all samples identified by BLAST as Saprolegnia, Achlya, or Leptolegnia (n = 68); (ii) three ATCC type strains that were cultured and sequenced in our lab (S. ferax [Gruithuisen] Thuret, S. parasitica Coker and A. americana Humphrey); (iii) 16 Saprolegnia, Achlya, or Leptolegnia (Leclerc et al 2000) that we downloaded from the GenBank NCBI database (TABLE II); and (iv) the non-Saprolegniaceae outgroup Phytophthora botryosa (ITS sequence GenBank AF266784
[GenBank]
, Cooke et al 2000). We saved the alignment in the Nexus format.
|
). We performed the distance analysis using the Jukes-Cantor option with equal rates for variable sites (Jukes and Cantor 1969). A bootstrap analysis of the neighbor joining tree was done with a neighbor joining search with 1000 replicates. Groups with 70% or greater frequency were retained. The parsimony analysis was done using the heuristic search option. The maximum number of trees saved was set to 2000. The parsimony consensus tree was computed with 70% majority rule. A bootstrap analysis of the parsimony consensus tree was done using a fast heuristic search with 1000 replicates. |
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). The remaining 43 sequences were true fungi: Trichoderma (n = 27), Mucor (n = 6), Verticillium (n = 3), Penicillium (n = 1), Cordyceps (n = 1), Engyodontium (n = 1), Gibberella (n = 1), Guignardia (n = 1), Leptosphaeria (n = 1) and one unidentified fungus. Because we did not sterilize our egg samples, it is possible that these true fungi were environmental contaminants that were present in the egg samples. While we considered it important to report all the organisms cultured from our amphibian eggs, we focused on the Saprolegniaceae for this study.
Of 884 total characters, 312 were parsimony informative, 411 were constant and 161 variable characters were parsimony uninformative. The neighbor joining and maximum parsimony analysis produced identical groupings of Leptolegnia, Saprolegnia, Achlya and S. semihypogyna. While the groupings were identical, the bootstrap support was higher in the branch groupings of the neighbor joining than the parsimony consensus tree. We chose to show the neighbor joining (FIG. 3) rather than the parsimony consensus tree to see the amount of evolutionary change and therefore determine how closely isolates were related within each grouping of Saprolegnia, Leptolegnia, Achlya or S. semihypogyna.
|
Our neighbor joining distance tree (FIG. 3) resolved field and reference samples into two major groups outside the Phytophthora outgroup. The first major group (bootstrap value 75) comprised two subgroups that further resolved into a total of six groupings. Thirteen isolates from amphibian eggs grouped strongly with the Leptolegnia reference sequence (bootstrap 100), and two egg samples separated from that group with strong support (bootstrap 100). A group including all Saprolegnia reference sequences except S. semihypogyna had strong support (bootstrap 91). The separation between the group including S. parasitica and S. diclina and the group including the other seven reference Saprolegnia had weaker support (bootstrap <70). Isolates from two Idaho-Montana amphibian egg samples grouped with S. parasitica ATCC 22284 (bootstrap 93) which was near but distinct from 14 amphibian samples that grouped strongly with S. diclina ATCC 90215 (bootstrap 100). Thirteen of the 14 isolates in the S. diclina grouping were from the Idaho-Montana cluster. A sample from a wild trout scraping (IS-13-1) also might be associated with the group including S. parasitica and S. diclina. The group containing S. salmonis, S. hypogyna and S. ferax ATCC 26116 included one field sample from a Chinook salmon scraping (IS-11-1). A grouping of S. bulbosa, S. oliviae, S. longicaulis and S. anomalies included 13 isolates from amphibian eggs and one isolate from eggs of hatchery rainbow trout (IS-12-1). With the exception of the hatchery trout, all samples in this group were collected in Oregon and Washington.
The second major group also was resolved into two subgroups. The Achlya group included all eight Achlya reference sequences and was resolved further into five groupings. Our finding of low bootstrap support (60) for the Achlya group concurs with other studies that imply the genus is likely to be polyphyletic (Leclerc et al 2000). Outside the three groups of Achlya reference samples were two groups of amphibian egg samples that were not directly affiliated with reference species. The first group (including IM-1-1, OW-20-1, OE-22-2, OW-21-1 and OE-22-3) was most closely related to the grouping of A. colorata and A. racemosa. The second group of egg samples (OW-23-3, WA-15-5 and WA-15-4) also was distinct from all our other Achlya sequences (bootstrap 100). Separate from the main Achlya group was a second subgroup including one amphibian egg sample with S. semihypogyna (bootstrap 99) and a distinct cluster of 12 amphibian egg isolates (bootstrap 100). All these samples came from our northern sites in Washington, Montana and Idaho. The generic and specific identities of these 12 isolates are unclear.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Our sequence identification and phylogenetic analysis confirm that a diversity of Saprolegniaceae occur on amphibian eggs in the Pacific Northwest. We estimate that we had representatives of at least 7–12 species and three genera of Saprolegniaceae on our amphibian eggs. Czeczuga et al (1998) also reported a diversity of taxa based on morphological identification, including 33 species of Saprolegniaceae (14 Achlya, 10 Leptolegnia, nine Saprolegnia) and 18 other zoosporic fungi from Polish amphibians raised in five different water sources.
Our phylogenetic analysis is in general agreement with recent molecular work on the Saprolegniaceae (e.g. Dick et al 1999, Riethmuller et al 1999, Leclerc et al 2000). Most (78%) of our oomycete samples (68) grouped within Saprolegnia and Achlya but we also identified a subset of our amphibian egg cultures as probable members of Leptolegnia (n = 13) or a related but separable group (bootstrap support of 100; n = 2). Few Leptolegnia species are documented in GenBank, so it is possible that our samples could be further resolved with more reference species. The separation of the Leptolegnia group from our primary Saprolegnia group is strongly supported (bootstrap 100) and generally concurs with phylogenies based on 18S rDNA (Dick et al 1999) and LSU rDNA data (Leclerc et al 2000). Our Leptolegnia samples came from four amphibians (A. macrodactylum, R. cascadae, R. luteiventris, R. pretiosa) and from all four states. Czeczuga et al (1998) reported L. caudata de Bary from eggs of five amphibians when they were reared in water from five different wetlands. Leptolegnia caudata and other members of the genus are pathogenic on mosquito larvae (Bisht et al 1996, Scholte et al 2004). Although not sampled specifically, mosquitoes were abundant at many of our sites.
Our neighbor joining distance analysis also suggests a distinct division between most of our Saprolegnia samples and members of the genus Achlya. This generally agrees with 28S rDNA data (Riethmuller et al 1999) and the cladistic analysis of LSU rDNA data reported by Leclerc et al (2000). In contrast a neighbor joining distance tree (Leclerc et al 2000) placed some Achlya (including A. racemosa, A. colorata, A. oligacantha and A. papillosa) closer to Saprolegnia than with the main Achlya clade (including A. aquatica, A. americana and A. intricata). Both our phylogeny and analysis by Leclerc et al (2000) of the LSU identify the same three Achlya subgroups: (i) A. americana/A. aquatica/A. intricata, (ii) A. oligacantha/A. papillosa and (iii) A. racemosa/A. colorata. These Achlya subgroups are consistent with divisions based on oospore morphology outlined by Dick (1969). None of our eight isolates from field samples directly matched sequences of our reference Achlya species, so we are unsure of their species-level taxonomy. Given the paucity of field sampling for Saprolegniaceae in western North America, it is possible this lineage represents a new species. Czeczuga et al (1998) reported 15 Achlya species (including A. colorata) from amphibian eggs in Poland, but little else is published on Achlya on amphibians. A variety of Achlya (including A. americana, A. colorata, and A. racemosa) have been reported on fish eggs (Czeczuga and Muszynska 1997, 1999).
Most phylogenetic work suggests that the genus Achlya is not a monophyletic unit in its current configuration (e.g. Green and Dick 1972, Dick et al 1999, Riethmuller et al 1999, Leclerc et al 2000). Similarly Leclerc et al (2000) indicated that Saprolegnia might not be monophyletic, and difficulties remain in distinguishing generic affiliations of some Achlya and Saprolegnia species. Our phylogeny grouped reference sequences of Saprolegnia (bootstrap 91) and Achlya together in relatively cohesive respective groups. However our S. semihypogyna and an associated group of field samples resolved more closely with Achlya than to the main group of Saprolegnia. Type specimens of S. semihypogyna were described from Japan (Inaba and Tokumasu 2002), and ITS and 28 LSU sequences are in GenBank. We did not inspect the morphology of any of our samples, but if our phylogeny is correct the generic attribution of S. semihypogyna may merit reconsideration. The identity of the tightly clustered group adjoining S. semihypogyna (bootstrap 99) and its relationship to other Achlya and Saprolegnia is unclear.
The distribution of samples among Saprolegnia species in our main group was somewhat unexpected. Fourteen isolates grouped strongly with S. diclina ATCC 90215. The strong support for our S. diclina group (bootstrap 100) and our S. parasitica group (bootstrap 93; n = 2 egg isolates) concurs with the conclusion by Molina et al (1995) that S. diclina and S. parasitica are closely related but separate species. Our S. diclina group was the most geographically homogeneous of our groups with larger sample sizes: 13 of 14 samples came from the Bitterroot Mountain region of Idaho-Montana. Also consistent with Molina et al (1995) was our finding of a close relationship between S. ferax and S. hypogyna.
Although others (Blaustein et al 1994, Kiesecker and Blaustein 1995) report S. ferax associated with amphibian egg mortality in the Pacific Northwest, none of our isolates from amphibian eggs were grouped closely with this species. Many of our isolates from amphibians were grouped closely with S. diclina and other Saprolegnia spp. (S. bulbosa, S. oliviae, S. anomalies and S. longicaulis). The single sample that aligned near our reference S. ferax came from a Chinook fish scraping (IS-11-1). Our two other fish samples were grouped with S. parasitica (sample IS-13-1) and S. anomalies/longicaulis (IS-12-1). The S. diclina/S. parasitica complex is commonly associated with saprolegniosis in fish around the world (e.g. Beakes and Ford 1983). Of note S. diclina colonized dead or unfertilized perch eggs in lab trials but did not invade adjacent live perch eggs (Paxton and Willoughby 2000).
Our lack of S. ferax seems noteworthy because it is among the most widespread and abundant taxa of its genus (Seymour 1970, Dick 1971, Czeczuga et al 1998, Johnson et al 2002). A recent study that combined genetic and morphological data (Hulvey et al 2007) showed that species designation of Saprolegnia based solely upon morphological characteristics is not sufficient. Because we used sequence rather than morphology for identification, we should not have encountered this problem to the same degree that earlier observational studies may have experienced. This might explain why we found a large diversity of Saprolegnia species on our amphibian eggs. We suggest that future identification of field-collected Saprolegnia with sequence and morphological data will contribute to a new understanding of distribution and ecological function of this diverse group in aquatic systems.
The effects of colonization by Saprolegniaceae on amphibian eggs and populations remain unclear. Most of the amphibian populations we sampled do not appear to be in decline (CAP and DSP unpublished data). Similar to Czeczuga et al (1998), we cultured Saprolegniaceae from amphibian eggs that were developing normally. Many pond-breeding amphibians deposit eggs among herbaceous vegetation in shallow margins, and these littoral zones can support the highest density and diversity of oomycete propagules in ponds or lakes (O’Sullivan 1965; Dick 1971, 1976). Several amphibians with this oviposition habit have adaptations to reduce egg losses to aquatic microorganisms, such as thickened egg capsules, separating egg masses to reduce direct hyphal invasion or accelerating development in presence of oomycete hyphae (Kiesecker and Blaustein 1997, Green 1999, Gomez-Mestre et al 2006, Touchon et al 2006). Similar to saprolegniosis in fish, it is unclear how frequently different members of the Saprolegniaceae act as pathogens on healthy amphibian eggs, colonize dead eggs (Robinson et al 2003) or take advantage of another stressor or infection (Kiesecker and Blaustein 1995, Lefcort et al 1997).
To better understand the threat posed by Saprolegniaceae to pond-breeding amphibians afield, we recommend additional work to clarify the taxonomy of the colonizing microorganisms, controlled tests of pathogenicity on individual amphibian species and experimental study of mechanisms by which stressors increase susceptibility of embryos.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Current address: USGS Forest and Rangeland Ecosystem Science Center, Snake River Field Station, 970 Lusk St., Boise, ID 83706 
1 Corresponding author. E-mail: petrisko{at}uidaho.edu Phone: (208) 529-8376. Current address: University of Idaho, 1776 Science Center Drive, Suite 205, Idaho Falls, ID 83402.
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Beakes GW, Ford H. 1983. Esterase isoenzyme variation in the genus Saprolegnia, with particular reference to the fish-pathogenic S. diclina-parasitica complex. J Gen Microbiol 129:2605–2619.
Bisht GS, Joshi C, Khulbe RD. 1996. Watermolds: potential biological control agents of malaria vector Anopheles culicifacies. Curr Sci 70:393–395.
Blaustein AR, Hokit DG, O’Hara RK, Holt RA. 1994. Pathogenic fungus contributes to amphibian losses in the Pacific Northwest. Biol Conserv 67:251–254.[CrossRef]
Cavalier-Smith T. 1997. Sagenista and Bigyra, two phyla of heterotrophic heterokont Chromists. Archiv für Protistenkunde 148:253–267.
Cooke DEL, Drenth A, Duncan JM, Wagels G, Brasier CM. 2000. A molecular phylogeny of Phytophthora and related Oomycetes. Fungal Genet Biol 30:17–32.[CrossRef][Medline]
Czeczuga B, Muszy
ska E. 1997. Aquatic fungi growing on the eggs of some anadromous fish species of the family Clupeidae. Acta Ichthyol Piscat 27:83–93.
———, ———. 1999. Aquatic fungi growing on percid fish eggs (Percidae) in Poland. Polish J Environ Stud 8:31–34.
———, ———, Krzeminska A. 1998. Aquatic fungi growing on the spawn of certain amphibians. Amphibia-Reptilia 19:239–251.
Daugherty J, Evans TM, Skillom T, Watson LE, Money NP. 1998. Evolution of spore release mechanisms in the Saprolegniaceae (Oomycetes): evidence from a phylogenetic analysis of internal transcribed spacer sequences. Fungal Genet Biol 24:354–363.[CrossRef][Medline]
Dick MW. 1969. Morphology and taxonomy of the Oomycetes, with special reference to Saprolegniaceae, Leptomitaceae and Pythiaceae I. Sexual reproduction. New Phytol 68:751–775.[CrossRef]
———. 1971. The ecology of Saprolegniaceae in lentic and littoral muds with a general theory of fungi in the lake ecosystem. J Gen Microbiol 65:325–337.
———. 1973. Saprolegniales. In: Ainsworth GC, Sparrow FK, Sussman AS, eds. The fungi, an advanced treatise. Vol IVB. New York: Academic Press. p 113–144.
———. 1976. The ecology of aquatic Phycomycetes. In: Jones EBG, ed. Recent advances in aquatic mycology. London: Elek Science. p 513–542.
———, Vick MC, Gibbings JG, Hedderson TA, Lopez Lastra CC. 1999. 18S rDNA for species of Leptolegnia and other Peronosporomycetes: justification for the subclass taxa Saprolegniomycetidae and Peronosporomycetidae and division of the Saprolegniaceae sensu lato into the Leptolegniaceae and Saprolegniaceae. Mycol Res 103:1119–1125.[CrossRef]
Ewing B, Hillier L, Wendl MC, Green P. 1998a. Base-calling of automated sequencer traces using PHRED I. Accuracy assessment. Genome Res 8:175–185.
———, Green P. 1998b. Base-calling of automated sequencer traces using PHRED II. Error Probabilities. Genome Res 8:186–194.
Gomez-Mestre I, Touchon JC, Warkentin KM. 2006. Amphibian embryo and parental defenses and a larval predator reduce egg mortality from water mold. Ecology 87:2570–2581.[CrossRef][Medline]
Green AJ. 1999. Implications of pathogenic fungi for life-history evolution in amphibians. Funct Ecol 13:573–575.[CrossRef]
Green BR, Dick MW. 1972. DNA base composition and the taxonomy of the Oomycetes. Can J Microbiol 18:963–968.[Medline]
Griffith GW, Shaw DS. 1998. Polymorphisms in Phytophthora infestans: Four mitochondrial haplotypes are detected after PCR amplification of DNA from pure cultures or from host lesions. Appl Environ Microbiol 64:4007–4014.
Hoffman GL. 1967. Parasites of North American freshwater fishes. Berkeley and Los Angeles: University of California Press. p 17–19.
Hulvey JP, Padgett DE, Bailey JC. 2007. Species boundaries within Saprolegnia (Saprolegniales, Oomycota) based on morphological and DNA sequence data. Mycologia 99:421–429.
Inaba S, Tokumasu S. 2002. Saprolegnia semihypogyna sp. nov., a saprolegniaceous oomycete isolated from soil in Japan. Mycoscience 43:73–76.[CrossRef]
Johnson TW Jr, Seymour RL, Padgett DE. 2002. Biology and systematics of the Saprolegniaceae. Online publication accessible at http://dl.uncw.edu/digilib/biology/fungi/taxonomy%20and%20systematics/padgett%20book/.
Jukes TH, Cantor CR. 1969. Evolution of protein molecules. In: Munro MN, ed. Mammalian protein metabolism. Vol. III. New York: Academic Press. p 21–132.
Kiesecker JM, Blaustein AR. 1995. Synergism between UV-B radiation and a pathogen magnifies amphibian embryo mortality in nature. Proc Natl Acad Sci 92:11049–11052.
———, ———. 1997. Influences of egg laying behavior on pathogenic infection of amphibian eggs. Conserv Biol 11:214–220.[CrossRef]
Leclerc MC, Guillot J, Deville M. 2000. Taxonomic and phylogenetic analysis of Saprolegniaceae (Oomycetes) inferred from LSU rDNA and ITS sequence comparisons. Antonie van Leeuwenhoek 77:369–377.[CrossRef][Medline]
Lefcort H, Hancock KA, Maur KM, Rostal DC. 1997. The effects of used motor oil, silt and the water mold Saprolegnia parasitica on the growth and survival of mole salamanders (Genus Ambystoma). Arch Envir Contam Toxicol 32:383–388.[CrossRef]
Molina FI, Jong S-C, Ma G. 1995. Molecular characterization and identification of Saprolegnia by restriction analysis of genes coding for ribosomal RNA. Antonie van Leeuwenhoek 68:65–74.[CrossRef][Medline]
O’Sullivan SM. 1965. A preliminary study of distribution of Saprolegniaceae in soils bordering freshwater areas together with a taxonomic study of the genus Isoachlya [Doctoral thesis]. Vols 1 and 2. London: University of London. 424 p.
Paxton CGM, Willoughby LG. 2000. Resistance of perch eggs to attack by aquatic fungi. J Fish Biol 57:562–570.[CrossRef]
Riethmüller A, Weiß M, Oberwinkler F. 1999. Phylogenetic studies of Saprolegniomycetidae and related groups based on nuclear large subunit ribosomal DNA sequences. Can J Bot 77:1790–1800.[CrossRef]
Robinson J, Griffiths RA, Jeffries P. 2003. Susceptibility of frog (Rana temporaria) and toad (Bufo bufo) eggs to invasion by Saprolegnia. Amphibia-Reptilia 24:261–268.
Scholte EJ, Knols BGJ, Samson RA, Takken W. 2004. Entomopathogenic fungi for mosquito control: a review. J Insect Sci 4:1–24.[Medline]
Seymour RL. 1970. The genus Saprolegnia. Nov Hedwig 19: IV-124.
Swofford DL. 2003. PAUP*: phylogenetic analysis using parsimony (*and other methods). Version 4.0. Sunderland, Massachusetts: Sinauer Associates.
Touchon JC, Gomez-Mestre I, Warkentin KM. 2006. Hatching plasticity in two temperate anurans: responses to a pathogen and predation cues. Can J Zool 84: 556–563.[CrossRef]
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Snisky JJ, White TJ, eds. PCR protocols—a guide to methods and applications. New York: Academic Press. p 315–322.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
