| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department Biology I and Geo-Bio Centre, LMU, Organismic Biology: Mycology, Menzinger Straße 67, D-80638, München, Germany, and Laboratoire d’Ecologie Appliquée, Faculté des Sciences Agronomiques, Université d’Abomey-Calavi, 01 BP 526, Cotonou, Benin
Reinhard Agerer
Department Biology I and Geo-Bio Centre, LMU, Organismic Biology: Mycology, Menzinger Straße 67, D-80638, München, Germany
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONLITERATURE CITED |
|---|
A common resupinate thelephoroid fungus was collected in northern Guinean seasonal forests in central and north of Benin (West Africa). The species is reminiscent of Tomentella umbrinospora with respect to the color and thickness of basidiomata and rhizomorphs, the shape of basidiospores in frontal view and the size of subicular hyphae. Both species fall phylogenetically within two clades. Based on detailed anatomical comparison (mostly of rhizomorphs and basidiospores) with the holotype of T. umbrinospora and phylogenetic analyses including ITS rDNA sequences of 40 Tomentella species, T. africana is described as a new species. Genetic distance between the newly described species and T. umbrinospora is 12.1–12.9%, based on ITS rDNA sequences. T. africana is characterized anatomically by yellow-brown thick (0.3–0.8 mm) monomitic rhizomorphs that are commonly covered by irregularly shaped thin hyphae, thin- to thick-walled subicular hyphae of two size ranges, clavate and clamped basidia of 30–60 µm and light yellow to pale brown echinulate basidiospores with irregular shape in frontal view. Detailed anatomical and molecular dissimilarities between T. africana and close species are discussed. Differences between irregularly shaped surface thin hyphae and skeletal ones are highlighted. We stress the relevance of rhizomorphal structures in the discrimination of resupinate thelephoroid fungi.
Key words: anatomy, hyphal system, ITS rDNA sequences-based phylogeny, rhizomorphal structure, T. Africana, T. umbrinospora, tropical Africa
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONLITERATURE CITED |
|---|
) presents some limitations because basidiospores of most species have irregularly shaped outlines. The shape of basidiospores is similar in many different species (Stalpers 1993). In such cases cystidia (Yorou et al 2007) and rhizomorphs respectively help in species delimitation. Rhizomorphs are indeed one of the most important discriminative elements within resupinate thelephoroid fungi (Kõljalg 1996, Stalpers 1993). Rhizomorphs have been defined as "multi-hyphal linear aggregates" (Cairney et al 2001), independent of their ontogenetical, anatomical or functional patterns. However their ontogeny and anatomical structures are of remarkable taxonomical value (Raidl 1997, Agerer 1987–2006) and have been used successfully to trace relationships within and between various fungal groups (Agerer 1999, 2002, 2006; Agerer and Iosifidou 2004; Iosifidou and Agerer 2002). Many resupinate thelephoroid species present constantly dimitic rhizomorphs composed of generative and skeletal hyphae, namely Tomentella ferruginea (Pers.) Pat., T. botryoides (Schwein.) Bourdot & Galzin, Pseudotomentella rhizopunctata E.C. Martini & Hentic and P. armata E.C. Martini & Hentic (Kõljalg 1996, Stalpers 1993, Loci 1997, Martini and Hentic 2002, 2003, Melo et al 1998). Some species, such as Tomentella radiosa (P. Karst.) Rick, T. ellisii (Sacc.) Jülich & Stalpers, T. italica (Sacc.) M.J. Larsen and T. sublilacina (Ellis & Holw.) Wakef. (Kõljalg 1996), show monomitic rhizomorphs. Both dimitic and monomitic rhizomorphs of Thelephorales may form chlamydospores (Agerer 1991, 1992, 1993, Martini and Hentic 2003, 2005) or irregularly shaped thin hyphae on their surface (Yorou et al 2007; Raidl and Müller 1996; Jakucs and Agerer 1999, 2001).
The present paper reports a yellow-brown to red-brown resupinate thelephoroid species we collected frequently in woodlands of central to north Benin (West Africa). The specimens assigned to this species represent more than 50% of our collections and occur either on soil or on the undersides of burned logs and bark. Macroscopic and some microscopic features of the specimens resemble those of Tomentella umbrinospora M.J. Larsen, a member of thelephoroid fungal group with putative worldwide distribution (Larsen 1968, 1974; Kõljalg 1996). Microscopic observations of the holotype of T. umbrinospora however revealed distinct anatomical dissimilarities regarding the structure of rhizomorphs, the size of basidiospores and of basidia. Anatomical features as well as molecular phylogenetic studies support the description of T. africana as a new species. This paper is the third part of a series dedicated to tropical African resupinate thelephoroid fungi.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONLITERATURE CITED |
|---|
). The holotype of T. umbrinospora was loaned from the herbarium of the New York State Museum. Color codes of dried basidiocarps are given according to Kornerup and Wanscher (1978). Herbaria names follow Holmgren et al (1990). We refer to Yorou et al (2007) and Yorou and Agerer (2007) for microscopic studies of specimens and line drawings. Descriptions follow criteria compiled by Kõljalg (1996). All studied specimens of T. africana and its holotype are deposited in M. An isotype is deposited in TU.
Scanning electron miscroscope (SEM) studies.— –
Small samples taken from fresh fruit bodies were fixed in 300–400 µL glutaraldehydecacodylate buffer and washed with tap water as follows: 60 min in 2.5% glutaraldehyde, gradual washing (5 min, 15 min, 30 min, 60 min) in a neutral cacodylate buffer (75 mM cacodylate, 2 mM MgCl2, 100 µL H2O, pH 7), 1–2 h incubation in 1% OsO4 buffer (2.5 ml OsO4, 7.5 mL H2O) with subsequent washing in distilled water. The samples were dehydrated gradually in a series of acetone solution as follows: 10% x 15 min, 20% x 15 min, 40% x 15 min, 60% x 15 min, 80% x 15 min, 100% x 15 min, 100% x 30 min. Samples were stored in 100% acetone overnight followed by critical point drying (Anderson 1951). Dehydrated samples were mounted on aluminium stubs by means of adhesive tape and then sputtered with platinum (60 s at 20 C and 20 mA) using a BALTEC SCD 050 sputter coater (BALTEC AG, Balzers, CH). Samples were examined with a LEO 438 VP E scanning electron microscope (LEO Electron Microscopy Inc., USA).
DNA extraction, amplification and sequencing.— –
DNA was extracted from fruit bodies according to Gardes and Bruns (1993) with a QIAGEN DNeasy plant Mini Kit (QIAGEN Inc., Hilden, Germany), according to the manufacturer’s instructions. PCR amplification was performed for internal transcribed spacers ITS1, ITS2 and for 5.8S region of the nuclear ribosomal DNA, using fungi-specific primer ITS1F (5' cttggtcatttagaggaagtaa 3') and basidiomycete-specific primer ITS4B (5' caggagacttgtacacggtccag 3'). PCR amplification was performed with Ready To GoTM beads (Amersham Pharamacia Biotech., Piscataway, New Jersey), with 24 µm of PCR solution (composed of 180 µm ddH2O, 30 µm buffer, 21.6 µm MgCl, 12 µm ITS1F, 12 µm ITS4B, 30 µm dNTP-Mix and 2.4 µm Taq-Polymerase) and 1 µm extracted DNA. The PCR was programmed as follows: 94 C for 3 min, 60 C for 1 min, 72 C for 1 min (1 cycle), 94 C for 1 min, 60 C for 1 min, 72 C for 1 min and 30 s (28 cycles), 94 C for 1 min, 60 C for 1 min and 72 C for 10 min (1 cycle). Amplified PCR products (2 µm) were run with bromophenol blue (2 µm) on 1% agarose gels for 30 min at 95 C, then stained in ethidium bromide for 10 min and in ddH2O for 1 min. PCR products were viewed under UV light. Successful DNA bands were purified with the QIAquick-PCR purification Kit (QIAGEN GmbH, Hilden, Germany) according to manufacturer’s instructions. DNA sequencing was performed by the sequencing service of the Institute for Genetics, Department Biology I (Ludwig-Maximilians-Universität, München), with BigDye Terminator Ready Reaction Cycles Sequencing Kit v3.1 (Applied Biosystems, Foster City, California). Sequencing was performed on 1 µm DNA probes plus 0.3 µm ITS1F (forward) and 0.3 µm ITS4B (reverse). Four sequences of the new species are deposited in GenBank NCBI with accession Nos. EF507253
[GenBank]
, EF507254
[GenBank]
, EF507255
[GenBank]
and EF507256.
Phylogenetic analysis.— –
The contiguous nucleotide sequences were edited with BioEdit v7.0.5 (Hall 2005). The sequences were submitted to BLAST and/or FASTA against nuclear ribosomal fungal sequence databases of UNITE (Kõljalg et al 2005) and of the National Centre for Biotechnology Information (NCBI) to test to what extent they match with ITS rDNA sequences of existing thelephoroid fungi. All selected sequences fall within the genus Tomentella. Sequences showing high identities score after BLAST were downloaded. Additional sequences published by Yorou et al (2007) and Kõljalg et al (2000, 2001) also were checked and added to the dataset. Alignment was performed with Clustal W Multiple (BioEdit v7.0.5) alignment and manually improved. Identity/similarity of sequences of closest species was calculated with the PAIRWISE ALIGNMENT option of BioEdit v7.0.5, after sequences were aligned and ambiguous regions deleted. Phylogenetic analyses were performed with PAUP version 4.0b10 (Swofford 2002). For maximum parsimony (MP) analysis we used the heuristic search option; starting tree(s) obtained via stepwise addition, 10 replications of random-taxon entry and tree bisection reconnection (TBR) swapping were selected. Gaps were treated as missing values. MASTREES reset to 10 000 and MULTREES option effective, steepest descent option not in effect, zero length branches collapsed. A neighbor joining (NJ) analysis was performed with the Kumira 2-parameter model (Kimura 1980). Bootstrap analysis was performed with 500 replicates under the heuristic search (Felsenstein 1985). All characters were assessed as independent, unordered and of equal weight with Fitch parsimony (Fitch 1971).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONLITERATURE CITED |
|---|
).
|
). In all analyses Tomentella umbrinospora, a species morphologically close to T. africana, falls within a different clade. Genetic distance between T. africana and T. umbrinospora were 12.1–12.9% according to the ITS rDNA sequences.
|
|
TAXONOMY |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONLITERATURE CITED |
|---|
–10
|
|
|
|
|
|
|
|
|
Chlamydosporae absentes.
Holotypus. – SYN 890 (M), GenBank NCBI, accession No. EF507256 [GenBank]
Basidiocarp resupinate, separable from the substrate, arachnoid, continuous, 0.5–1.5 mm thick. Hymenophore dark-brown (6E7) to chestnut (6F7) in mature basidiocarps, granulose to cavernous, with red brown drops in fresh condition, subiculum yellowish, paler than hymenophore, sterile margin mostly indeterminate.
Rhizomorphs present in subiculum and at the margins, abundant, thick and sometimes visible with the naked eye, 0.3–0.8 mm thick, compact (FIG. 2
), yellow-brown under a dissection microscope, yellow to pale brown in water and in 2.5% KOH, monomitic, of type C (Agerer 1999, Agerer 1987–2006); young rhizomorphs (thinner than 20 µm) smooth (FIG. 3), colorless to light yellow (in water and in 2.5% KOH), old rhizomorphs (thicker than 20 µm) yellow to yellow brown (in water and in 2.5% KOH), covered by dense and irregularly shaped thin hyphae (FIG. 4); superficial thin hyphae 0.5–1.5(–2) µm diam (FIG. 5), emerging from generative hyphae (FIG. 6), frequently branched, simple septate, entwined, plectenchymatous in surface, sometimes growing along and around generative hyphae; internal hyphae (hyphae below surface and central hyphae) clamped, simple septa common (FIG. 7) and occurring in short intervals (5–10 µm), thin- to thick-walled (0.2–0.5 µm), slightly yellow to yellow-brown (in water and in 2.5% KOH), not congophilous, not cyanophilous, not amyloid, hyphae below surface 1–2.5 µm, central hyphae wider 2.5–6(7) µm.
Subicular hyphae usually clamped, simple septa common, light yellow to yellow (in water and 2.5% KOH), of two size ranges (FIG. 8), some with 1–1.5(–2) µm diam, thin-walled, others with 2.5–4.5(–5) µm diam, thin- to thick-walled (0.2–0.5 µm), rarely with brown drops (in water and 2.5% KOH) on their surface, neither congophilous, nor cyanophilous, nor amyloid.
Subhymenial hyphae always clamped, simple septa absent, 3.5–6(7) µm wide, thin-walled (0.2 µm), yellowish (in water and in 2.5% KOH), slightly congophilous and slightly cyanophilous, not amyloid.
Cystidia absent.
Basidia (30–)35–58(–60) µm long, 7.5–10 µm wide at apex and 4–6.5 µm wide at base, consistently clamped at base, clavate, not stalked, rarely sinuous, transverse septa absent, colorless to light yellow (in water and in 2.5% KOH), slightly congophilous and slightly cyanophilous, not amyloid, sometimes with granular content then neither congophilous nor cyanophilous, 4-sterigmate, sterigmata 7–9 µm long and 2–2.5 µm wide at base. Basidiospores 7.5–9(–9.5) x 7.5–8.5(–9) µm in frontal face and 7.5–9(9.5) x 7.5–8(9) µm in lateral face, with irregular shape in frontal view, sometimes subglobose, sometimes triangular to lobed (FIG. 9), ellipsoid in lateral view (FIG. 10), light yellow to pale brown (in water and in 2.5% KOH), echinulate, aculei dense, irregular in size (0.5–1,5 µm), oil drops infrequent, not congophilous, not cyanophilous, not amyloid.
Chlamydospores absent.
Type material. – Benin, central part, Borgou province, forest reserve of Wari-Maro, Wari-Maro region, 08°12'25.6''N, 002°47'31.8''E, on the undersides of dead bark, 06 Aug 2005, leg. NS Yorou, SYN 890 (M), Holotype in M, isotype in TU. GenBank NCBI, accession No. EF507256.
Additional material studied: Benin, Borgou province, Sinendé region, forest close to Fô-Bouko village, 10°8'46.6''N, 002°15'6.0''E, on logs, 22 Aug 2003, leg. R. Agerer, RA 13780 (M); RA 13802 (M). Benin, Borgou province, reserved forest of Wari-Maro, Agbassa region, 08°55'44.5''N, 002°20'45.1''E, on logs, 23 Aug 2003, leg. R. Agerer, RA 13831 (M); on burned bark and logs, 16 Jun 2004, leg. NS Yorou, SYN 655 (M). Benin, Borgou province, reserved forest of Wari-Maro, Wari-Maro region, 09°00'47.1''N, 002°01'36.9''E, on soil, leaf litter, logs and dead bark, 05 Aug 2005, leg. NS Yorou, SYN 840 (M); SYN 843 (M); SYN 866 (M); SYN 871 (M); Wari-Maro region, 08°12'25.6''N, 002°47'31.8'', on soil, leaf litter, logs and dead bark, 06 Aug 2005, leg. NS Yorou, SYN 882 (M); SYN 888 (M); SYN 891 (M); 18 Aug 2006, leg. NS Yorou, SYN 945 (M), GenBank NCBI, accession No. EF507253. Benin, Atacora province, forest reserve of Alibori supérieur, Ouassa Pehunco region, 10°08'14.67''N, 2°19'31.70''E, on soil, under leaf litter, 20 Aug 2006, leg. NS Yorou SYN 991 (M) GenBank NCBI, accession No. EF507254 [GenBank] ; SYN 1007 (M), GenBank NCBI, accession No. EF507255.
Habitat and ecology. – Basidiocarps occur in abundance as continuous but thick films on the soil surface, just under leaf litter of native trees or on the undersides of dead and/or partly burned barks and logs. Tomentella africana is common in woodlands dominated by Isoberlinia doka Craib & Stapf and Isoberlinia. tomentosa (Harms) Craib & Stapf (Ceasal-Ceasalpiniaceae).
Etymology. – The epithet refers to the origin of the holotype and the commonness of the species in woodlands and savannahs of Benin (West Africa).
Tomentella umbrinospora M. J. Larsen FIGS. 11–13
|
|
|
Basidiocarp resupinate, separable from the substrate, arachnoid, continuous, 0.5–1 mm thick. Hymenophore brown (6D3-6E3), dark-brown (6E7) to chestnut (6F7) in mature basidiocarps, granulose, subiculum yellowish, paler than hymenophore, sterile margin byssoid, concolorous with subiculum.
Rhizomorphs present in subiculum and at the margins, thick, visible already at 10x under dissection microscope, yellow to light brown (in water and 2.5% KOH), dimitic, of type C, always covered by skeletal hyphae (FIG. 11), skeletal hyphae abundant, simple septa common, 0.5–1.5(–2) µm, colorless to light yellow (in water and 2.5% KOH), not congophilous, neither cyanophilous nor amyloid; hyphae below surface clamped, simple septa present (FIG. 12), thin-walled, colorless (in water and 2.5% KOH), congophilous, slightly cyanophilous, not amyloid; adjoining inner hyphae 2–4.5 µm, thin-walled (0.3 µm), sometimes strongly encrusted, encrustation observable in water and in cotton blue, rapidly and completely dissolving in 2.5% KOH and partly in Congo red; central hyphae 6–8(–9) µm. Subicular hyphae clamped, simple septa rare, 2.5–4(–5) µm diam, light yellow to pale brown (in water and 2.5% KOH), thin-walled (0.2–0.3 µm), strongly encrusted (observable in water and in cotton blue), encrustation rapidly and completely dissolving in 2.5% KOH leading to yellow-green to yellow-brown solution that is observable with the naked eye, partly dissolving in Congo red, skeletal hyphae sometimes present in the subiculum, 0.5–1.5(–2) µm diam, subicular hyphae colourless to light yellow, slightly congophilous, slightly cyanophilous, not amyloid.
Subhymenial hyphae clamped; 2.5–4(–6) µm diam, simple septa absent, thin-walled (0.3 µm), strongly encrusted (in water and in Congo red), encrustation rapidly dissolving in 2.5% KOH, colorless to light yellow (in water and in 2.5% KOH), slightly congophilous and slightly cyanophilous, not amyloid.
Cystidia absent.
Basidia (35–)40–60(–65) µm long, (3.5)4–7(9) µm wide at apex and 3–4 µm wide at base, clamped at base, narrow clavate to clavate (FIG. 13), not stalked, sometimes sinuous, sometimes with transverse septa, colorless to light yellow, sometimes ochraceous (in water and in 2.5% KOH) with granular contents, slightly congophilous, not cyanophilous, not amyloid, 4-sterigmate, sterigmata 4–6 µm long and 1–1.5 µm wide at base, sterigmata rarely with transverse septa.
Basidiospores (5.5–)6–7.5(–8.5) x (5.5–)6–7(–8) µm in frontal face and 6–7.5(–8) x 5.5–7(–8) µm in lateral face, with irregular shape in frontal view, sometimes subglobose to triangular, rarely lobed; ellipsoid in lateral view, thin to thick-walled (0.5 µm), light yellow to pale brown (in water and 2.5% KOH), echinulate, aculei short, 0.1–0.8(–1) µm, oil drops infrequent, not congophilous, not cyanophilous, not amyloid.
Chlamydospores absent.
Material studied. – Holotype of T. umbrinospora, received from USA, New York, Greenbush, on hardwood, leg. C.H. Peck, herb. 2648 (NYS). (Protolog of T. umbrinospora: Forestry Syracuse Univ., Tech. Publ. 93:61. 1968).
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONLITERATURE CITED |
|---|
, O’Brien et al 2005). Pairwise base differences among T. africana, T. umbrinospora and T. lateritia, coupled with differential anatomorphological characteristics (see below) strongly suggest T. africana as a new separate species. T. africana has many macroscopic and microscopic similarities to T. umbrinospora. Macroscopic similarities include the thickness of the basidiocarp (0.5–1.5 mm for T. africana and 0.5–1 mm for T. umbrinospora), the yellow-brown thick rhizomorphs, the yellowish subiculum and the dark-brown to chestnut hymenium. A common microscopic feature between both species is the basidisopores with irregular shape in the frontal view. Basidiospores of T. umbrinospora however are smaller, with shorter aculei than those of T. africana. Furthermore basidia of T. umbrinospora are narrower than those of T. africana. Transverse septa are present sometimes in basidia and sterigmata of T. umbrinospora. An interesting feature that has been reported only recently within resupinate thelephoroid fungi is the presence of irregularly shaped thin hyphae on the rhizomorph surface of some species (Yorou et al 2007; Raidl 1997; Raidl and Müller 1996; Jakucs and Agerer 1999, 2001). The ontogeny of such thin surface hyphae has been addressed by Raidl (1997). In this paper, we address the difference between such thin hyphae and skeletal ones.
Skeletal hyphae are described as regularly cylindrical, long but often sinuous and rarely septate thick-walled hyphae (Hartig 1885, Falck 1912, Corner 1932). Clemençon (1997) supplemented the description of skeletals by mentioning the scarcity of branches and incrustation. Skeletal hyphae are reported to be nonamyloid, noncyanophilous but slightly congophilous (Clémençon 1997). Simple septa like those in generative hyphae lack. However adventitious or false septa resulting from dried protoplasm (Ryvarden and Johansen 1980) can be frequent exclusively at the tips of hyphae (Clémençon 1997). Skeletal hyphae are common within Polyporaceae where they play a key role in the delimitation of genera and species (Ryvarden 1978, 1991; Ryvarden and Gilbertson 1987, 1993, 1994; Ryvarden and Johansen 1980). They also have been reported in few corticioid genera such as Amylostereum Boidin, Persoon ex Patrouillard and Thelephora Ehrhart ex Willdenow (Kõljalg 1996; Larsen 1968, 1974; Stalpers 1993) to name but a few. However, within thelephoroid fungi, thin, often only slightly thick-walled, multiseptate hyphae are designated skeletals. They often are associated with rhizomorphs. Their presence in the subiculum of tomentelloid fungi has been rarely reported. However, due to their multiseptate status and the mostly only slightly thick walls and their frequently present cytoplasm, it is questionable whether it is justified to designate these hyphae as skeletals in Falck’s (1912) sense, Corner’s (1932) definition and Clémençon’s (1997) re-evaluation.
Dimitic rhizomorphs with so-called skeletal hyphae 1–2 µm wide have been reported for Tomentella umbrinospora (Melo et al 1998, Larsen 1974, Kõljalg 1996, Losi 1997). However Kõljalg (1996) stated that rhizomorphs collected below the subiculum may be momomitic, lacking thus skeletal hyphae, while Stalpers (1993) mentioned the scarcity of skeletal hyphae in this species. The holotype of Tomentella umbrinospora we examined presented dimitic rhizomorphs. Skeletal hyphae 0.5–1.5(–2) µm diam with numerous simple septa are common on the surface of all examined rhizomorphs of Tomentella umbrinospora. This is in accordance with the original descriptions of T. umbrinospora (Larsen 1968, 1974), which mentioned dimitic hyphal systems for this species. Unlike T. umbrinospora that presented a dimitic hyphal system, T. africana presented a monomitic hyphal system. Skeletal hyphae were not observed in the subiculum or on rhizomorphs. All subicular hyphae are clamped and present also numerous simple septa. The smaller subicular hyphae of T. africana resemble skeletal hyphae of T. umbrinospora. However they differ considerably in the presence of clamps and therefore cannot be regarded as skeletals, particularly because they possess only thin walls. In later developmental stages all rhizomorphs of T. africana are covered by dense, irregularly shaped thin hyphae. Unlike so-called skeletal hyphae, the irregularly shaped thin hyphae are short, tortuous, multiply branched and intermingling, resulting in a dense plectenchymatous cover of the rhizomorph surface.
Many resupinate thelephoropid species we collected in Benin woodlands showed only small pieces of basidiocarps on fragmented substrate. This is partly due to the annual occurrence of bush fires in woodlands and savannahs of tropical Africa, which regularly burn substrates (litter, dead bark and logs), thus jeopardizing the development of basidiocarps of resupinate, lignicolous fungi. However one interesting ecological feature of T. africana is the frequency of its basidiocarp in these areas. Basidiocarps of T. africana occur in abundance on soil mainly under Isoberlinia doka and Isoberlinia tomentosa, or on the underside of dead and/or burned bark and logs. T. africana is undoubtedly the most abundant resupinate thelephoroid fungus in woodlands and savannahs of the Soudanian Centre of Endemism. The absence of this species in dense semideciduous relic forests lacking ectomycorrhizal trees of southern Benin, coupled with its abundance in woodlands and seasonal forests of central to north Benin, suggests that it is an ectomycorrhizal former with native trees.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Corresponding author. E-mail: yorou2001{at}yahoo.fr
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONLITERATURE CITED |
|---|
———. 1991. Ectomycorrhizae of Sarcodon imbricatus on Norway spruce and their chlamydospores. Mycorrhiza 1:21–30.
———. 1992. Ectomycorrhizae of Phellodon niger on Norway spruce and their chlamydospores. Mycorrhiza 2:47–52.
———. 1993. Ectomychorrhizae of Hydnellum peckei on Norway spruce and their chlamydospores. Mycologia 85:74–83.[CrossRef]
———. 1999. Never change a functional successful principle: the evolution of Boletales s. l. (Hymenomycetes, Basidiomycota) as seen from below-ground features. Sendtnera 6:5–91.
———. 2002. Rhizomorph structures confirm the relationship between Lycoperdales and Agaricaceae (Hymenomycetes, Basidiomycota). Nov Hedwig 75:367–385.[CrossRef]
———. 2006. Fungal relationship and structural identity of their ectomycorrhizae. Mycol Progress 5:67–107.[CrossRef]
———, Iosifidou P. 2004. Rhizomorph structures of Hymenomycetes: a possibility to test DNA-based phylogenetic hypotheses. In: Agerer R, Piepenbring M, Blanz P, eds. Frontiers in basidiomycote mycology IHW-Verlag, Eching. p 249–302.
Anderson TF. 1951. Techniques for the preservation of three-dimensional structure in preparing specimens for the electron microscope. Trans NY Acad Sci, II 12:130–134.
Cairney JWG, Jennings DH, Agerer R. 2001. The nomenclature of fungal multihyphal linear aggregates. Crytogam Bot 2/3:246–251.
Clémençon H. 1997. Anatomie der Hymenomyceten. Eine Einführung in die Cytologie und Plectologie der Krustenpilz, Porlinge, Keulenpilz, Leistlinge, Blätterpilz und Röhrlinge mit 842 Figuren. Université de Lausanne. 998 p.
Corner EJH. 1932. The fruit body of Polystictus xanthopus. Fr-Ann Bot 46:71–111.
de Kesel A. 2001. A mushroom dryer for the travelling mycologist. Field Mycol 2:131–133.
Eriksson J, Ryvarden L. 1975. The Corticiaceae of North Europa. Vol. 3. Oslo: Fungiflora.
———, Hjortstam K, Ryvarden L. 1978. The Corticiaceae of North Europa. Vol. 5. Oslo: Fungiflora.
Falck R. 1912. Die Meruliusfäule des Bauholzes. Neue Untersuchungen über Unterscheidung, Verbreitung, Entstehung und Bekämpfung des echten Hausschwammes. Hausschwammforschung. Vol. 6. Jena: Fischer.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791.[CrossRef]
Fitch WM. 1971. Toward defining the course of evolution: minimum change for a specified tree topology. Syst Zool 20:406–416.[Abstract]
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes—application to the identification of mycorrhizae and rusts. Mol Ecol 2:113–118.[Medline]
Hall T. 2005. BioEdit, biological sequence alignment editor for Win95/98/NT/2K/XP. Carlsbad, California: Ibis therapeutic.
Hartig R. 1885. Die Zerstörung des Baumholzes durch Pilze. I. Der echte Hausschwamm Merulius lacrymans Fr. Berlin: Springer.
Holmgren PK, Holmgren NH, Barnett LC. 1990. Index herbarium. I. Herbaria of the world. 8th ed. Regnum Vegetabile 120. New York: New York Botanical Garden.
Iosifidou P, Agerer R. 2002. Die Rhizomorphen von Gastrosporium simplex und einige Gedanken zur systematischen Stellung der Gastrosporiaceae (Hymenomycetes, Basidiomycota). Feddes Repertorium 113:11–23.[CrossRef]
Jakucs E, ———. 1999. Tomentela pilosa (Burt) Bourdot & Galzin + Populus alba L. Descr Ectomyc 4:135–140.
———, ———. 2001. Tomentella subtestacea Bourdot & Galzin + Populus alba L. Descr Ectomyc 5:215–219.
Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotides sequences. J Mol Evol 16:111–120.[CrossRef][Medline]
Kõljalg U. 1996. Tomentella (Basidiomycota) and related genera in temperate Eurasia. Synop Fungar 9:1–213.
———, Dahlberg A, Taylor AFS, Larsson E, Hallenberg N, Stendil J, Larsson K-H, Fransson PM, Kårén O, Jonsson L. 2000. Diversity and abundance of resupinate thelephoroid fungi as ectomycorrhizal symbionts in Swedish boreal forests. Mol Ecol 9:1985–1996.[CrossRef][Medline]
———, Jackus E, Bóka K, Agerer R. 2001. Three ectomycorrhizae with cystidia formed by different Tomentella species as revealed by rDNA ITS sequences and anatomical characteristics. Folia Cryptog Estonica Fasc 38:27–39.
———, Larsson KH, Abarenkov K, Nilsson RH, Alexander IJ, Eberhardt U, Erland S, Hoiland K, Kjoller R, Larsson E, Pennanen T, Sen R, Taylor AF, Tedersoo L, Vralstad T, Ursing BM. 2005. UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi. New Phytol 166:1063–1078.[CrossRef][Medline]
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. 3rd ed. London: Eyre Methuen, Politikens Forlag. 252 p.
Larsen MJ. 1968. Tomentelloid fungi of North America. State Univ. New York Coll. Forest. At Syracus Univ., Tech Publ 93:1–157.
———. 1974. A contribution to the taxonomy of the Genus Tomentella. Mycol Mem 4:1–145.
Losi C. 1997. Macrofungus flora of the lagoon of Venice and adjacent areas (Italy). Non-gilled basidiomycètes. I. Tomentelloid fungi. Mycotaxon 64:243–259.
Martini EC, Hentic R. 2002. Deux nouvelles espèces de champignons tomentelloides. Bull Soc Mycol Fr 118:79–90.
———, ———. 2003. Pseudotomentella rhizopunctata sp. nov. Une nouvelle espèce de champignon tromentelloid chlamydosporée. Bull Soc Mycol Fr 119:19–29.
———, ———. 2005. Tomentella lilacinogrisea et T. guadalupensis sp nov. Deux espèces de champignons tomentelloides des Caraibes. Bull Soc Mycol Fr 121:17–27.
Melo I, Salcedo I, Tellería MT. 1998. Contribution to the knowledge of Tomentelloid fungi in the Iberian Peninsula. Folia Cryptog Estonica 33:77–84.
O’Brien HE, Parrent JL, Jackson JA, Moncalvo J-M, Vilgalys R. 2005. Fungal community analysis by large-scale sequencing of environmental samples. Appl Environ Microbiol 71:5544–5550.
Raidl S. 1997. Studien zur Ontogenie an Rhizomorphen von Ektomykorrhizen. Mit 84 Abbildungen im Text. Bibliotheca Mycologica 169:184.
———, Müller WR. 1996. Tomentella ferruginea (Pers.) Pat. + Fagus sylvatica L. Descr Ectomyc 1:161–166.
Ryvarden L. 1978. The Polyporaceae of North Europa. Vol 2. Oslo: Fungiflora.
———. 1991. Genera of Polypores. Nomenclature and taxonomy. Synopsis Fungarium. Oslo: Fungiflora.
———, Gilbertson RL. 1987. North American Polypores. Vol II. Oslo: Fungiflora.
———, ———. 1993. European Polypores. 1. Oslo: Fungiflora.
———, ———. 1994. European Polypores. 2. Oslo: Fungiflora.
———, Johansen I. 1980. A preliminary Polypore flora of East Africa. Oslo: Fungiflora.
Stalpers JA. 1993. The Aphyllophoraceous fungi I-Keys to the species of the Thelephorales. Studies in Mycology. 35. Centraalbureau Voor Schimmelcultures BAARN and DELFT, 1–170.
Swofford DL. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods). Version 4. Sunderland, Massachusetts: Sinauer Associates.
Tedersoo L, Kõljalg U, Hallenberg N, Larsson K-H. 2003. Fine scale distribution of ectomycorrhizal fungi and roots across substrate layers including coarse woody debris in a mixed forest. New Phytologist 159:153–165.[CrossRef]
Yorou SN, Agerer R. 2007. Tomentella furcata, a new species from Benin (West Africa) with basidia forming internal hyphae. Mycol Progress. (DOI 10.1007/s11557-007-0543-z).
———, Kõljalg U, Sinsin B, Agerer R. 2007. Studies in African thelephoroid fungi. 1. Tomentella capitata and Tomentella brunneocystidia, two new species from Benin (West Africa) with capitate cystidia. Mycol Progress 6(1):7–18.[CrossRef]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
