| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Chemistry and Biochemistry, California State University, 1250 Bellflower Boulevard, Long Beach, California 90840
Yara Aweiss
Ching-yu Lu
Flora Banuett 1
Department of Biological Sciences, California State University, 1250 Bellflower Boulevard, Long Beach, California 90840 In memoriam Ira Herskowitz
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Ustilago maydis is a Basidiomycete fungus that exhibits a yeast-like nonpathogenic form and a dikaryotic filamentous pathogenic form. Generation of these two forms is controlled by two mating type loci, a and b. The fungus undergoes additional morphological transitions in the plant that result in formation of a third cell type, the teliospore. The fuz1 gene is necessary for this developmental program. Here we report cloning and sequencing of fuz1 and show that it contains an open reading frame with coding capacity for a protein of 1421 amino acids. The Fuz1 protein belongs to the family of MYND Zn finger domain proteins. We generate a null mutation in strains of opposite mating type and show that fuz1 is necessary for conjugation tube formation, a morphological transition that occurs in response to pheromones. We generate fuz1– diploid strains heterozygous at a and b and show that fuz1 is also necessary for postfusion events (maintenance of filamentous growth). We also demonstrate that fuz1 is necessary for cell morphogenesis of the yeast-like cell: normal cell length, location and number of septa, cell separation and constriction of the neck region. Fuz1 is also required for cell wall integrity and to prevent secretion of a dark pigment. We propose that the MYND domain may interact with different proteins to regulate cell morphogenesis.
Key words: cell separation, conjugation tube, filamentous growth, pigment production, septum location
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
, 2002; Feldbrügge et al 2004, Klosterman et al 2007). The dimorphic switch is crucial to pathogenicity; the yeast-like form is nonpathogenic whereas the filamentous dikaryon is pathogenic. Growth of the filamentous pathogenic dikaryon leads to formation of tumors in its hosts, maize (Zea mays L) and teosinte (Zea mays ssp. parviglumis and spp. mexicana) (reviewed in Banuett 2002, Christensen 1963, Klosterman et al 2007). In addition to the dimorphic switch, the fungus undergoes extensive morphological changes within the tumors that result in formation of a distinct cell type, the teliospore (Banuett and Herskowtiz 1996, Snetselaar and Mims 1994). Teliospores undergo meiosis to produce the haploid phase (reviewed in Christensen 1963, Banuett 2002, Klosterman et al 2007). Because the developmental program leading to teliospore formation does not occur outside the plant it has been hypothesized that plant signals trigger this pathway (Banuett and Herskowitz 1996, Regenfelder et al 1997, Ruiz-Herrera et al 1999).
The dimorphic switch is genetically programmed by two mating type loci (a and b) and by environmental conditions (reviewed in Banuett 1995, 2002; Feldbrüügge et al 2004, Kahmann and Schirawski 2007, Klosterman et al 2007). The a locus has two alleles, a1 and a2 (Rowell and DeVay 1954); each contains a pheromone precursor and pheromone receptor gene (Bülker et al 1992) that regulate conjugation tube formation and cell fusion of haploid strains (Banuett and Herskowitz 1994a, b; Snetselaar et al 1996, Spellig et al 1994) and filamentous growth on charcoal agar (Banuett and Herskowitz 1989, Bölker et al 1992, Spellig et al 1994) but not in planta (Banuett and Herskowitz 1996, Regenfelder et al 1997). The b locus is multiallelic with at least 25 naturally occurring alleles (Puhalla 1970, Rowell and DeVay 1954; reviewed in Banuett 2007, Holliday 1974, Klosterman et al 2007). Each allele contains two genes, bW and bE, that code for homeodomain proteins (Gillissen et al 1992, Kronstad and Leong 1990, Schulz et al 1990). The bW and bE polypeptides coded by different b alleles interact to form a combinatorial activity (bWx–bEy) that regulates gene expression in the filamentous dikaryon (Babu et al 2005, Brachmann et al 2001, Kömper et al 1995, Nugent et al 2004, Yee and Kronstad 1998; reviewed in Banuett 2007, Kahmann and Schirawski 2007). The b locus is the major determinant of pathogenicity and filamentous growth and also is implicated in control of meiosis (Day et al 1971, Puhalla 1970, Rowell and DeVay 1954; reviewed in Banuett 2007, Kahmann and Schirawski 2007).
The yeast-like unicellular haploid form is elongated, approximately 15–18 µm long and 5 µm wide and forms a bud once per cell cycle at one of the cell poles, slightly off center (Banuett and Herskowitz 2002, Holliday 1974, Jacobs et al 1994). U. maydis yeast-like cells can use the same bud site repeatedly as in apiculate yeasts or they can choose a new bud site at the same or opposite pole (Jacobs et al 1994), but the mechanisms by which one pole is chosen versus the other remain unknown. The bud grows by incorporation of new cell wall material at the tip with no phase of isotropic growth (Banuett and Herskowitz 2002). The final shape of the bud results from a progression of morphological changes, from an initial cylindrical or conical structure to a bulbous intermediate and finally to the elongated cell with tapered ends (Banuett and Herskowitz 2002). In large-budded cells before cell separation, two septa are present, one on the mother side of the neck region and the other on the bud side of the neck region. The septum on the mother side forms before that in the daughter cell (Banuett and Herskowitz 2002, O’Donnell and McLaughlin 1984, Weinzierl et al 2002). These two septa are separated by a zone of less densely staining cell wall material, the fragmentation zone, where cell separation occurs (Banuett and Herskowitz 2002, O’Donnell and McLaughlin 1984, Weinzierl et al 2002). The actin and microtubule cytoskeleton have been implicated in bud morphogenesis (Banuett and Herskowitz 2002, Steinberg et al 2001).
The fuz1 gene was isolated in a screen for mutants unable to form filaments when mated with a wild type strain of opposite mating type (Banuett, 1991). The fuz1 gene is unlinked to the mating type loci (Banuett 1991). In plant inoculations with wild type and fuz1 mutant strains of opposite mating type (for example, a1 b1 fuz1+ + a2 b2 fuz1–) tumor response and teliospore production are no different than those observed in inoculations with wild type strains. In contrast, in inoculations with fuz1 mutants of opposite mating type (for example, a1 b1 fuz1– + a2 b2 fuz1–), the tumors are small, white, restricted in location and do not produce teliospores; thus the sexual cycle cannot be completed (Banuett and Herskowitz 1996). A time course comparison of the infectious process between wild type strains (for example, a1 b1 + a2 b2) with those between fuz1 mutant strains of opposite mating type indicates that the fuz1 mutant strains can form filaments in the plant and these filaments do not differ in appearance from those observed in wild type inoculations (Banuett and Herskowitz 1996).
Teliospore formation involves a discrete developmental pathway in which hyphae become embedded in a mucilaginous matrix and then fragment and release cylindrical cells that undergo cell rounding to become the teliospores (Banuett and Herskowitz 1996; reviewed in Banuett 2002, Klosterman et al 2007). Interestingly, infections with fuz1 mutant strains of opposite mating type cause uniform arrest of the teliospore developmental program at the hyphal fragmentation stage (Banuett and Herskowitz 1996). The fuz1 mutant hyphae are unable to fragment, become aberrantly shaped and exhibit abnormal cytoplasmic protrusions not observed in wild type hyphae (Banuett and Herskowitz 1996).
These observations prompted us to examine the role of fuz1 in cell morphogenesis of the yeast-like cell and in the dimorphic switch. Here we report the cloning of the fuz1 gene and show that fuz1 codes for a MYND Zn finger domain protein that is required for the morphological differentiation in response to pheromones, for events at the junction of cells, for cell wall integrity and to control release of a dark pigment.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). YEPS (Tsukuda et al 1988) was used for routine growth of U. maydis strains. UMC broth (U. maydis complete, Holliday 1974) was used for growth of strains to be tested on charcoal agar (the fuzz reaction, Banuett and Herskowitz 1989). Charcoal agar is as described (Holliday 1974). Strains to be tested on charcoal agar were cross-streaked against standard tester strains (a1 b1 [FB1], a2 b2 [FB2], a2 b1 [FB6a], and a1 b2 [FB6b]) or spotted and compared to diploids (a1/a2 b1/b2 [FBD-12] and a1/a2 b1/b1 [FBD12-3]) (Banuett and Herskowitz 1989). Plates were sealed with Parafilm and incubated at room temperature. For replica mating 0.3 mL of an overnight culture of a1 b1 (FB1) were spread on charcoal agar medium (Banuett and Herskowitz 1989, Banuett 1991) onto which 2 to 3 d old colonies of a2 b2 fuz1– (FBf10-1i) transformants, grown on YEPS agar at 28 C, were replica mated. YEPS 1 M sorbitol supplemented with hygromycin B (200 µg/mL) or carboxin (2 µg/mL) or with both drugs was used respectively for selection of transformants or fuz12 diploids. Transformants and diploids were purified on the same medium without sorbitol.
|
Enzymes and reagents.— – Restriction endonucleases were from Roche or New England BioLabs; Expand Polymerase, DIG-labeling kit, RNAse A and Southern analysis buffers from Roche; AmpliTaq and dNTPs from ABI; chemicals for the preparation of buffers and media from Sigma and Fisher Scientific Co.; DNeasy Plant DNA kit for isolation of genomic DNA and QIAquick Gel extraction Kit from QIAGEN; Hygromycin B from Calbiochem; lysing enzymes, Congo Red, thiabendazole, Calcofluor 28, and DAPI (4',6'-diamidino-2-phenylindoledihydrocloride) from Sigma; Ampicillin from US Biological; and X-Gal from Gold Biotechnology. Oligonucleotides were synthesized by InVitrogen.
Light microscopy.— – Cells were observed with Nomarski interference and epifluorescence optics with a BX61 Olympus microscope equipped with an ORCA CCD camera (Hamamatsu) and images captured with Simple PCI imaging software (Scientific Instruments, San Francisco, California), and processed with Adobe Photoshop 7.0.
Cell wall, septum and nuclear staining.— –
Procedures used were described in Banuett and Herskowitz 2002.
Growth of fuz1 mutant and wild type strains on different media.— –
Fuz1 mutant (FBf10-1i, FBf10-3c, FB18, FB19, FB20, FB21) and wild type strains (FB1, FB2) (TABLE I
) were grown in YEPS broth until saturation. Tenfold serial dilutions of each strain were prepared in a 96-well microtiter plate and an aliquot of each dilution for each strain spotted onto YEPS agar and YEPS agar containing 1M sorbitol, 1M KCl, 1M NaCl, 1.2M NaCl, 10 µg/mL or 20 µg/mL thiabendazole, Calcofluor white (40 µg/mL) or Congo red (50 µg/mL). Strains also were streaked on the same media. The plates were incubated at 28 C and colony growth and morphology were recorded over several days and photographed with a Nikon digital camera. At least three independent tests were carried out on a given day on three different days.
DNA-mediated transformation of U. maydis.— –
Strains grown in YEPS broth were transformed according to Fotheringham and Holloman (1989) or Wang et al (1988).
Cloning fuz1 by functional complementation.— –
Strain FBf10-1i (a2 b2 fuz1–) (Banuett 1991; TABLE I) was transformed with a cosmid library and approximately 3000 hygromycin resistant transformants were replica mated onto a lawn of a1 b1 (FB1) cells on charcoal agar medium, as described above, and screened for colonies that form filaments with the wild type strain (Fuz+ phenotype in a Fuz– background, FIG. 1A). Fuz+ colonies were purified, grown in UMC broth overnight and cross-streaked on charcoal agar versus standard tester strains FB1 (a1 b1) and FB2 (a2 b2) (TABLE I). As controls FB1 was streaked versus FB2 and FB1 and FBf10-1i versus FB1 and FB2. Genomic DNA from two Fuz+ candidate strains (37a-3 and 38a-11) was obtained as described in Wang et al (1988) and Banuett and Herskowitz (1994) to recover the integrated cosmid and flanking DNA and treated with restriction endonucleases BglII, BamHI or StuI, which do not cut within the vector (pBR322), self-ligated, and an aliquot was used to transform E. coli DH5
and DH5 mcr strains (InVitrogen).
|
and treated with restriction endonuclease BamHI. Seven plasmids, derived from treatment with the above restriction enzymes, were analyzed; three contain identical inserts, whereas the rest have different inserts. Nucleotide sequence of the vector-junction was generated from three different plasmids with a vector-derived primer. This sequence information was used to generate a 43-mer insert-specific oligonucleotide (FB75), which was labeled with T4 polynucleotide kinase as described in Sambrook and Russell (2001) and used for colony hybridization of E. coli DH5 cells transformed with the cosmid subpool from which the original fuz1+ transformants had been obtained. Cosmid DNA was isolated from 10 E. coli colonies that produced a positive signal, and one of the cosmids was shown to complement the fuz1– mutation after introduction into strains FBf10-1i (a2 b2 fuz1–) and FBf10-3c (a1 b1 fuz1–). The fuz1 cosmid was designated p12.
Subcloning fuz1 from cosmid p12.— –
Treatment of cosmid p12 with restriction enzyme BamHI generated 4 fragments of approximately 20, 12, 9 and 5 kb. The 12, 9 and 5 kb fragments were isolated and ligated into BamHI-treated plasmid pHL1 (Wang et al 1988) to generate plasmids p12-F12, p12-F36 and p12-F1 respectively. These plasmids were transformed into U. maydis strain FBf10-1i (a2 b2 fuz1–) and hygromycin resistant transformants were cross-streaked on charcoal agar versus tester strains as described above. Transformants that contained p12-F1 produced a positive fuzz reaction with tester strain a1 b1 (FB1) but not with a2 b2 (FB2), whereas transformants with p12-F12 and p12-F36 did not. The 5 kb BamHI fragment also was ligated into pUC19 (BRL/InVitrogen) to generate p19F1, which was used to generate an internal deletion of the ORF (see below).
DNA sequencing and sequence analysis.— –
Double-strand sequencing was performed with the Sequenase 2.0 kit with universal and custom-synthesized primers. The templates (pUC derived plasmids or a pBR322-derived cosmid) were denatured by standard procedures. The sequence of the 5 kb BamHI fragment in p19F1, described above, contains an open reading frame of approximately 1800 nucleotides that is truncated at its 3' end (FIG. 2A), which might explain why plasmid p12-F1 results in ,45% Fuz+ colonies upon transformation of the a2 b2 fuz1– strain. The remaining sequence was generated with cosmid p12 as template. The derived amino acid sequence of the putative Fuz1 protein was compared with proteins in the NCBI database with BLAST analysis (http://www.ncbi.nlm.nih.gov/blast) (Altschul et al 1997). Sequence alignment was carried out with MultAlin (Corpet 1988) and Clustal W (Thompson et al 1994).
|
and also using a PCR-ligation free method (J. Shorts, Y. Aweiss and F. Banuett pers comm). A 1.5 kb fragment from the 5' UTR region immediately upstream of the ORF was amplified from genomic DNA by PCR with primers FBU130 (5' GTTAATTAACGCGCGCTG CGAAGCTCAAGCC) and FBU131 (5' GAATGGCCATC TAGGCCTACCACAGGAGGGAGAATGTC) (FIG. 2B). Similarly a 1.5 kb fragment from the 3' UTR region immediately downstream of the ORF was amplified with primers FBU132 (5 ' GAATGGCCTGAGTGGCCTACCGCGATTCCATTAGCATG) and FBU133 (5' GGTTAATTAAGGTGCTGCAGCAAA GGCGGCGG) (FIG. 2B). Primers FBU130 and FBU 133 introduce a PacI restriction enzyme site (underlined) and primers FBU131 and FBU132 a modified SfiI restriction site (underlined) (see Brachmann et al 2004). The amplified fragments were cloned into pCR2.1 TOPO (InVitrogen) to generate respectively plasmids pCR5F1 and pCR3F1. Orientation of the 5' and 3' UTR fragments in these plasmids was confirmed by restriction enzyme analysis with BsaI and XcmI, respectively. Plasmids pCR5F1 and pCR3F1 were treated with SfiI and XbaI, fractionated on a 0.7% agarose gel, and the 1.75 kb fragment from pCR5F1 and the 5.5 kb fragment from pCR3F1 were gel purified and ligated with the SfiI hygromycin cassette from plasmid pMF-1h (Brachmann et al 2004) to generate pCR2.1 TOPO containing the 59UTR-hygB-39UTR targeting fragment that lacks the entire ORF (pCR-Dfuz1). The targeting fragment was released by treatment with restriction endonuclease PacI, gel purified after fractionation on a 1% agarose gel, introduced into haploid strains a1 b1 (FB1) and a2 b2 (FB2) and transformants selected as described above.
Deletion of the ORF was ascertained by PCR with primers FBU108 (5' AGCGTGTCTGTCATGTGC) and FBU114 (5' CTCGCTGGTAGTTACCAC) or FBU107 (5' AGACCG AATGGAGGATCG) and FBU115 (5' GGAGGAGATGAC TACCTCG) (FIG. 2B). Primer FBU108 is upstream of FBU130; FBU107 is downstream of FBU133; and FBU114 and FBU115 are within the hygB gene (FIG. 2B). PCR amplification with the above sets of primers generates a 2.3 kb fragment in the null mutant strains and no fragment in wild type strains (data not shown). The presence of the ORF was detected with ORF-specific primers FBU011 (5' TGCGCCTTGCACGTGATGCCG) and FBU180 (5' GG CGCGCTTAATTAAGAGCTCCATGCTAATGGAATCGCG) (FIG. 2B), which amplify a 1.5 kb fragment in wild type strains and no fragment in the null strains (data not shown). This analysis was followed by Southern hybridization as described below.
To generate a 459 bp internal deletion of the fuz1 ORF, plasmid p19F1 (pUC19 containing a 5 kb BamHI fuz1 complementing fragment) was treated with XhoI, which cuts twice within the fuz1 ORF, to generate fragments of approximately 6.5 kb and 459 bp. The 6.5 kb fragment was gel purified, and ligated with a 2.0 kb Xho-SalI fragment containing the hygromycin cassette from plasmid pHL1 (Wang et al 1988) to give rise to plasmid p19F1
XhoI:: hygB. This internal deletion leaves 504 nucleotides at the 5' end of the ORF and 3300 nucleotides for the remainder of the ORF and replaces the deleted fragment with the hygromycin cassette. A BamHI fragment containing the construct was introduced into strain a1 b1 (FB1). Thirty-two hygromycin resistant transformants were tested for the Fuz phenotype on charcoal agar (see MATERIALS AND METHODS) and for other phenotypes (see RESULTS). Twenty-three transformants exhibited a Fuz– phenotype and the remaining nine were Fuz+ (data not shown).
Isolation of genomic DNA and Southern hybridization analysis.— –
Protoplasts for isolation of genomic DNA were prepared from 10–50 mL cultures as described (Wang et al 1988, see also Banuett and Herskowitz 1994a) and subjected to the procedure described in the DNeasy Plant DNA kit (QIAGEN). For Southern hybridization analysis, genomic DNA from Fuz– and Fuz+ transformants, and from the parental wild type strains (FB2 and FB1) (TABLE I) was digested with restriction endonuclease MscI, fractionated on a 0.7% agarose gel and transferred to an Immobilon membrane (Millipore). Conditions for transfer were as described in Sambrook and Russell (2001) and the manufacturers of the membrane (Millipore) and the DIG-labeling kit (Roche). The membrane was probed with a 520 bp DIG-labeled PCR fragment from the fuz1 5' UTR region (see below). The membrane was reprobed with a 872 bp DIG-labeled PCR fragment from the HygB gene in pHL1 (Wang et al 1988) (see below). In some cases the membrane also was reprobed with a 1.5 kb DIG-labeled PCR fragment from the ORF region. For Southern hybridization analysis of the internal deletion mutant, DNA was digested with BamHI, fractionated, and transferred as above and probed with a 1.8 kb DIG-labeled BstEII probe (see below). In control strains (FB1 and FB2) a 4.5 kb band is detected, whereas in the Fuz– transformants a 6.0 kb band (data not shown). Fuz+ transformants contain the wild type band and an additional band indicative of a nonhomologous integration event (data not shown).
Labeling of DNA probes for Southern hybridization.— –
The following probes were labeled with the PCR DIG-labeling kit (Roche) (see FIG. 2B): a 520 bp fragment from the fuz1 5' UTR region with primers FBU145 (5' CTCACGACTTGACT CACACG) and FBU146 (5'GCCGAGGATGATGCTG AATG); a 872 bp fragment from the hygB gene with primers FBU79 (5' GCGAGTACTTCTACACAG) and FBU80 (5' GCTTTCAGCTTCGATGTAGG); and a 1.5 kb fragment from the ORF region with primers FBU011 and FBU180, described above. A BstEII fragment that encompasses part of the ORF and the 5'UTR region was labeled randomly and used in the analysis of the internal deletion mutant. PCR fragment probes were gel purified with the QIAquick Gel extraction kit (QIAGEN) before use.
Generation of a full length fuz1-complementing plasmid.— –
A 9.2 kb fragment containing the entire fuz1 ORF (~4.3 kb) and flanking regions (~3 kb of 5' and ~2 kb of 3') was amplified from genomic DNA with primers FBU302 (5' GAGTCTAGAGCTGCGGCTTTGTAGTTG) and FBU303 (5' GAGAAGCTTCCAGCCAAGATCATCCAG), which respectively introduce XbaI and HindIII sites (underlined). The amplified fragment was gel purified, cloned into pCM619 (Kojic and Holloman 2000) to generate pCM-fuz1 and introduced into strains a2 b2 fuz1– (FBf10-1i), a2 b2 fuz1 (FB18), and a1 b1 fuz1 (FB21) with selection for carboxin-resistant transformants. Purified transformants were tested for complementation of the different phenotypes conferred by the fuz1– mutation. All phenotypes were rescued by this autonomously replicating plasmid (data not shown).
PCR amplifications.— – PCR amplifications were carried out in a MJR (MJ Research Inc., USA) or Biometra (Biometra biomedizinische Analytik GmbH, Göttingen, Germany) thermal cycler. For amplification of the fuz1 5' and 3' UTR regions, 25 cycles (15 s denaturation at 94 C, 30 s annealing at 58–62 C, and 2 min extension at 68 C) were carried out with Expand Polymerase (Roche) and 50–100 ng of genomic DNA. For amplification of the entire ORF and flanking regions (~9.2 kb in total), 50–100 ng of genomic DNA were subjected to 25 cycles (15 s at 94 C, 30 s annealing at 61 C and 8 min extension at 68 C with Expand Polymerase [Roche]). For amplification of genomic DNA from hygromycin resistant transformants, 100 ng of genomic DNA were subjected to 30 cycles (30 s denaturation at 94 C, 30 s annealing at 55–62 C, and 45–120 s extension at 72 C) with AmpliTaq (ABI). For amplification of DNA to generate DIG-labeled probes, conditions recommended by the manufacturer (Roche) were followed.
Conjugation tube assay.— –
Conjugation tube formation was assayed as described by Banuett and Herskowtiz (1994a, b). Strains were grown in YEPS until saturation. Aliquots were used to inoculate minimum medium with reduced nitrogen and 0.1% charcoal, grown till saturation, and concentrated fivefold (see Banuett and Herskowitz 1994b). An equal volume of cells (0.5 mL) from two different strains was mixed in 5 mL of fresh medium, incubated at 28 C with gentle shaking (60–80 rpm), aliquots taken at 1 h intervals beginning 2 h after mixing and continued 16–24 h. Mixtures were: i. FB1 (a1 b1) and FB2 (a2 b2); ii. FB1 and FBf10-1i (a2 b2 fuz1–); iii. FB1 and FB18 (a2 b2 fuz1); iv. FB2 and FBf10-3c (a1 b1 fuz1–); v. FB2 and FB21 (a1 b1 fuz1); (f) FBf10-1i and FBf10-3c; vi. FB18 and FB21. Formation of conjugation tubes was examined microscopically with Nomarski optics. Some samples also were stained with DAPI and examined with epifluorescence optics to ascertain nuclear position and migration. Pure cultures of each strain were grown under the same conditions.
Generation of fuz1– diploids.— –
Strain a1 b1 fuz1– (FBf10-3c) was transformed with plasmid pCBX122 (Keon et al 1991), with selection for carboxin resistant transformants, to generate strain FB3c-cbx; strain FB2 was transformed with pCM54 (Tsukuda et al 1988), with selection for hygromycin resistant transformants, to generate strain FB2-H. Strains FB18 (a2 b2 fuz1:: hygB), FB3c-cbx (a1 b1 fuz1– [pCBX122]), and FB2-H (a2 b2 [pCM54]) were grown overnight to OD600 0.9–1.0 in YEPS broth supplemented with hygromycin or carboxin, protoplasts prepared as described above, and 0.2 mL protoplasts (~1 x 108/mL) of FB2-H and FB3c-cbx or FB3c-cbx and FB18 were mixed and treated as for transformation. Diploids were selected on hygromycin carboxin agar (see above), colonies purified on the same medium without sorbitol, grown in UMC broth and tested for filamentous growth by spotting on charcoal agar. Their sensitivity to Congo red was determined as for fuz1– haploid strains, as described above. Heterozygosity at the b locus was determined by Southern hybridization analysis as described in Banuett and Herskowitz (1994a).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
) with a predicted MW 153.84 KDa and a pI of 6 (GenBank accession No. EU035495
[GenBank]
; MUMDB um02587 (http://mips.gsf.de/genre/proj/ustilago/). The putative Fuz1 protein contains two regions with significant similarity to other proteins in the databases (FIGS. 2A, 3). A domain of 100 amino acid residues (692–791; FIGS. 2A, 3) located near the middle of the protein contains a MYND-type Zn finger domain, which is conserved in diverse eukaryotic proteins (CDD, Marchler-Bauer et al 2007). The MYND domain extends from amino acid 745 to 791 (FIGS. 2A, 3). The residues immediately upstream of this domain are highly conserved among the fungal proteins but not among nonfungal MYND domain-containing proteins. An amino terminal domain of approximately 140 amino acid residues (FIGS. 2, 3) shared with other fungal proteins, some of which (Aspergillus nidulans SamB and Saccharomyces cerevisiae Mub1) are involved in fungal morphogenesis (Krüger and Fischer 1998). The function of the other fungal proteins is not known. An additional block of 26 amino acid residues is found near the middle of the protein (amino acid residues 628–653, FIG. 2A) and is shared with the same fungal proteins. The putative Fuz1 protein also contains two histidine-rich regions (residues 531–542) and (residues 568–576), and a glutamine rich region (499–577), which are not present in the other proteins (FIG. 2A). Several potential PKC and PKA phosphorylation sites and myristoylation sites are present (Prosite, Falquet et al 2002).
|
) (see MATERIALS AND METHODS). Introduction of the targeting fragment (see MATERIALS AND METHODS) into haploid strains a2 b2 (FB2) and a1 b1 (FB1) and cross-streaking the transformants on charcoal agar against tester strains (see MATERIALS AND METHODS) revealed that 40% and 60% of FB2 and FB1 transformants, respectively, exhibited a Fuz– phenotype (no filaments or reduced filament formation) and the remaining a Fuz+ phenotype. The Fuz– transformants could be due to gene replacement by homologous recombination or de novo inactivation of another gene by nonhomologous recombination. Gene replacement was confirmed by PCR and Southern hybridization analysis (see MATERIALS AND METHODS). The latter analysis showed that a 5.5 kb band present in wild type control strains was shifted to a band of faster mobility of 2.5 kb in all Fuz– strains (FIG. 4A), when probed with a 5' UTR fragment, as expected for a gene replacement event, whereas the Fuz+ transformants contained two bands, one corresponding to the band observed in control strains (5.5 kb) and another band of different mobility than that observed in Fuz– strains (data not shown). These observations indicate that the wild type fuz1 gene had been replaced by the null allele (fuz1:: hygB) in the Fuz– strains, whereas the targeting fragment had integrated at nonhomologous loci in the Fuz+ strains (data not shown). The result was confirmed further by probing the same membrane with a hygB-specific fragment (FIG. 4B) or with an ORF-specific probe (data not shown) (see MATERIALS AND METHODS).
|
), whereas cross-streaking of a1 b1 fuz1+ + a2 b2 fuz1 yields reduced filament formation (FIG. 1B) and cross-streaking of a1 b1 fuz1 + a2 b2 fuz1 results in absence or further reduction of filament formation after 48–96 h incubation (FIG. 1B). Thus the fuz1 null mutant behaves similarly to the original UV-induced mutant and to the fuz1 mutant with a small internal deletion of the ORF (data not shown). These results are consistent with a role of fuz1 in filament formation on charcoal agar (see Banuett 1991).
Role of fuz1 in conjugation tube formation..
Because formation of dikaryotic filaments involves cell fusion and filamentous growth of the fusion product (the dikaryon), reduced filament formation on charcoal agar (FIG. 1B) could result from a requirement of fuz1 for either or both of these processes. Cell fusion and filamentous growth can be assayed independently with the appropriate strains (see for example Banuett and Herskowitz 1989, 1994a; Dürrenberger and Kronstad 1999, Gold et al 1994, Regenfelder et al 1997, Spellig et al 1994). Before cell fusion cells form conjugation tubes, a morphological differentiation that occurs in response to pheromones produced by cells of opposite mating type (Banuett and Herskowitz 1994a, b; Snetselaar et al 1996, Spellig et al 1994). To determine if fuz1 is required for conjugation tube formation, we assayed this process in coculture of different strains in low nitrogen medium containing charcoal (see MATERIALS AND METHODS; Banuett and Herskowitz 1994a, b). Pure cultures of the wild type and fuz1 mutant strains arrest as unbudded cells when grown in low nitrogen medium (FIG. 5A, L). Coculture of wild type haploid strains (a1 b1 + a2 b2) resulted in emergence of conjugation tubes approximately 3.5 h after the cells were mixed (FIG. 5B, C). Greater than 90% of the cells exhibited a response (1000 cells examined) consistent with previous observations that the response is rapid—begins approximately 3 h after mixing—and is synchronous—90% of cells respond (Banuett and Herskowitz 1994a, b). The conjugation tubes exhibited the characteristic sinuous appearance (FIG. 5B, C), which is distinct from that of the dikaryotic filaments (FIG. 5D). The conjugation tubes continued to elongate and at 8 h, long, straight-growing filaments (FIG. 5D) were present and contained two nuclei in the tip cell (FIG. 5F), indicative of cell fusion and formation of the dikaryon. These filaments became more numerous with prolonged incubation time (FIG. 5E); after overnight incubation (16–24 h) a mat of white filaments was visible on the surface of the liquid (data not shown). In coculture of wild type and fuz1– or wild type and fuz1 strains carrying different a and b alleles conjugation tubes first appear at 6.5–7.5 h or later after mixing of the different strains (FIG. 5G–I), a delay of 3 or more h compared to the wild type strains. The number of cells with conjugation tubes is reduced at least 100-fold compared to that observed in coculture of wild type strains (
1000 cells examined for each combination of strains). After overnight incubation reduced numbers of dikaryotic filaments are observed compared to coculture of wild type haploid strains (FIG. 5H, I). In coculture of strains that carry different a and b alleles and the same fuz1 mutation, conjugation tube formation is reduced at least 10-fold compared to the mixture of wild type and fuz1 mutant strains (FIG. 5J, K), that is at least 1000-fold with respect to the wild type strains. Even after overnight incubation conjugation tubes were observed rarely and few or no dikaryotic filaments were present (FIG. 5K). These observations indicate that fuz1 is required for conjugation tube formation and for timing of this morphological response.
|
fuz1/fuz1–) and diploids heterozygous for fuz1 (a1/a2 b1/b2 fuz1/fuz1+) (see MATERIALS AND METHODS) and spotted them on charcoal agar. The heterozygous fuz1 (a1/a2 b1/b2 fuz1/fuz1+) strain formed mycelial colonies (Fuz+ phenotype) (data not shown) indistinguishable from those of diploids homozygous for fuz1+ (a1/a2 b1/b2 fuz1+/fuz1+) (FIG. 1Ca), whereas the a1/a2 b1/b2 fuz1/ fuz1– diploid did not form filaments (Fuz– phenotype) (FIG. 1Cc, d, e), similar to a1/a2 b1/b1 diploids (FBD12-3) (FIG. 1Cb). These results indicate that fuz1 is required for maintenance of filamentous growth, a postfusion event.
fuz1 mutants exhibit altered colony and cell morphology.— –
To determine the role of fuz1 in cell morphogenesis, we undertook a detailed analysis of colony and cell morphology of fuz1 mutants and wild type strains. fuz1 mutants exhibit altered colony morphology characterized by ridges (undulations) that contrast with the smoother surface of the wild type parental strain (c.f. FIG. 6C, D and 6A, B). Because altered colony morphology might be due to altered cell morphology, we determined cell morphology in asynchronous exponentially growing cultures of fuz1 null mutant strains (a2 b2 fuz1:: hygB [FB18]; a1 b1 fuz1:: hygB [FB21]) and fuz1– mutant haploid strains of different mating types containing the original UV-induced mutation (a2 b2 fuz1– [FBf10-1i], a1 b1 fuz1– [FBf10-3c], a2 b1 fuz1– [FBf10-5j], a1 b2 fuz1– [FBf10-1c]), wild type haploid strains (a1 b1 fuz1+ [FB1], a2 b2 fuz1+ [FB2]) and a wild type diploid strain (a1/a2 b1/b2 fuz1+/fuz1+ [FBD-12]) (TABLE I) with Nomarski differential optics (see MATERIALS AND METHODS). Different fields were examined for cell length measurements. A total of 350 fuz1– cells of different mating types, 100 wild type haploid cells and 100 wild type diploid cells were analyzed during early log phase of growth. fuz1– cells, regardless of mating type, are at least 1.6x longer than the parental wild type cells (26 ± 0.7 [fuz1–] vs. 15.5 ± 0.5 µm [wt]) (cf. FIG. 7B and A) and slightly longer than diploid cells (data not shown). Diploid cells are 1.5x longer (23 ± 0.32 um) than haploid cells as previously shown (Banuett and Herskowitz 1994). These observations indicate that the fuz1 gene is required for normal cell length.
|
|
), indicating that the fuz1– mutation interferes with normal cell separation. The mother cell budded next to the original site of budding and the daughter budded at its distal end with respect to its site of birth (FIG. 7C), never near its site of birth. The mother was capable of budding multiple times from the junction with the daughter cell (FIG. 7B, C). These observations indicate that fuz1 is required for cell separation of yeast-like cells. The cell separation phenotype was not suppressed by cAMP (data not shown) as observed for ubc mutants (defective in the regulatory subunit of cAMP-dependent protein kinase, which also exhibit a cell separation defect) (Gold et al 1994).
DAPI staining of fuz1 mutant cells showed a centrally located nucleus throughout most of the cell cycle as in wild type cells (FIG. 7D), which migrates to the bud (data not shown), where it divides, as in wild type cells (Banuett and Herskowitz 2002, Holliday 1965, O’Donnell and MacLaughlin 1984, Steinberg et al 2001). These observations indicate that the fuz1 gene is not necessary for normal nuclear migration and position in the yeast-like cell.
Cultures of Fuz1– strains become darkly pigmented after 72 h incubation (FIG. 8C, D), whereas cultures of Fuz1+ strains remained light yellow (FIG. 8A, B), which is the color of the broth. A darkly pigmented supernatant and a whitish pellet are obtained after centrifugation of the culture (data not shown). Microscopic observation indicates that the cell walls are not darkly pigmented. These results indicate that the pigment is secreted and not present in the cell walls. Furthermore, colonies formed by fuz1 mutants also become darkly pigmented (FIG. 10G). The fuz1 gene therefore normally inhibits release of a dark pigment by cells in liquid culture and solid agar medium.
|
|
). Wild type cells have a narrow neck (FIG. 9A, B) (see Banuett and Herskowitz 2002). These observations indicate that fuz1 plays a role in constriction of the neck and might suggest a role in cytokinesis or septum formation. We thus viewed septa in asynchronous exponentially growing populations of fuz1 mutant and wild type cells by staining with Congo red, as described in Banuett and Herskowitz (2002), which stains chitin and other cell wall components (Roncero and Duran 1985), and examined them with epifluorescence microscopy. Large-budded wild type cells contain one or two septa in the neck region between mother and bud, depending on the stage of cell separation (FIG. 9A, B) (see Banuett and Herskowitz 2002). In fuz1 mutant cells multiple septa locate in the neck region or its vicinity (FIG. 9C, F, G). Some of the septa are aberrant; in other cases they are mislocalized to the bud (FIG. 9E, H). These observations indicate that the fuz1 gene is required for proper formation, location and number of septa.
|
, Roncero and Duran 1985) (see MATERIALS AND METHODS). Growth of fuz1– and fuz1 null mutant strains was severely inhibited by these compounds suggesting that the mutants have altered cell wall properties or composition (FIG. 10D, E). The strains also exhibit reduced growth on rich medium containing high salt (cf. FIG. 10C and FIG. 10A) (see MATERIALS AND METHODS), indicating that fuz1– mutants are sensitive to increased salt concentration in the medium and supports the notion that the mutants have a defective cell wall. Growth of the mutants is reduced slightly on rich medium containing 1M sorbitol (FIG. 10B). The presence of the microtubule depolymerizing drug thiabendazole did not affect growth of the mutant strains to a greater degree than that of wild type strains (data not shown).
The fuz1 null mutant colonies exhibit sectors of dark-and light-pigmented areas (FIG. 10H). The light sectors are larger in the FB2 than in the FB1 background (FIG. 10H). The original UV-induced mutants exhibit reduced sectoring. These observations suggest that bypass suppressors of the fuz1 null mutation or suppressors of pigment production arise readily in culture. Alternatively, the strain may exhibit mitotic instability. Analysis of cellular morphology from the light-pigmented and darkly pigmented sectors indicates that cells exhibit the same Fuz1 mutant cell morphology phenotype (data not shown), consistent with the notion that suppressors of pigment production and not bypass suppressors of the deletion arise readily in culture in strains lacking the fuz1 gene. Sectoring appears to be more extensive in the FB2 than in the FB1 background (cf. Fig. 10He, f and g, with h). The reason for this difference is not known. Strains FB1 and FB2 are sister segregants from a single meiosis (Banuett and Herskowitz 1989), thus they are congenic not isogenic strains and therefore may carry modifiers responsible for the observed differences.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). The domain is named after myeloid translocation protein 8 MTG8 (Miyoshi et al 1993), Nervy (Feinstein et al 1995) and DEAF-1 (Gross and McGinnis 1996) and consists of seven cysteine residues and one histidine residue arranged in a C4-C2HC consensus ([CH]-X(2,4)-C-X(7,17)-C-X(0,2)-C-X(4)-[YFT]-C-X(3)-[CH]-X(6,9)-H-X(3,4)-C). The MYND domain has been implicated in protein-protein interactions, in particular in recruitment of partners for proteins involved in transcriptional regulation (Spadaccini et al 2006 and references therein).
Fungal homologues of Fuz1 share a highly conserved hydrophobic amino-terminus domain of unknown function. They also share a highly conserved stretch of amino acids immediately upstream of the MYND domain, which is not present in nonfungal proteins. Whether this region contributes to function of the fungal MYND domain remains to be determined. Little is known of the role of the fungal MYND-domain proteins, except for Aspergillus nidulans SamB and Saccharomyces cerevisiae Mub1 (Krüger and Fischer 1998) (see below). Our work provides information on a new member of this group of fungal proteins and supports a role in fungal morphogenesis.
fuz1 is necessary for conjugation tube formation and for maintenance of filamentous growth.— –
Because formation of dikaryotic filaments requires two basic steps, cell fusion and growth of the dikaryon as a filament, mutations that abolish the first step also abolish the second, whereas those that abolish the second do not necessarily affect the first. To distinguish between these possibilities we made use of different assays and different sets of strains. First, using a liquid assay and haploid strains (Banuett and Herskowitz, 1994b), we demonstrated that fuz1 is required for formation of conjugation tubes; a fuz1 null mutation blocks this morphological differentiation in coculture of two fuz1 mutants. Conjugation tube formation occurs in response to pheromones produced by cells of opposite mating type. This response requires different a alleles but is independent of the b locus (Banuett and Herskowitz 1994a, b; Snetselaar et al 1996, Spellig et al 1994). Thus fuz1 participates in this a-locus dependent pathway. Fuz1 may be a downstream target of the pheromone response pathway or an upstream regulator that controls expression of one or more components of the pathway.
The weak reaction observed in coculture of wild type and fuz1 mutants could be due to inability of the fuz1 mutants to respond to the pheromone produced by the wild type strain. In this scenario the fuz1 mutant is thought to produce some pheromone that elicits a weak response in the wild type strain. Alternatively, fuz1 mutants cannot produce pheromone but the pheromone produced by the wild type strain elicits a weak response in the mutant. Future experiments might help distinguish these possibilities.
We made use of diploids that bypass the cell fusion step to examine the role of fuz1 in postfusion events and demonstrated that fuz1 is necessary for maintenance of filamentous growth. Filamentous growth of diploids and dikaryons on charcoal agar requires different a and b alleles (Banuett and Herskowitz 1989, 1994b; Bölker et al 1992, Day et al 1971, Holliday 1961, Puhalla 1968, Ruiz-Herrera et al 1995, Spellig et al 1994). Diploids homozygous at a and heterozygous at b or homozygous at b and heterozygous at a are nonmycelial (Banuett and Herskowitz 1989, Day et al 1971, Holliday 1961, Puhalla 1968). Inactivation of both fuz1 alleles in a diploid heterozygous at a and b blocks formation of filaments. fuz1 could function in the a-dependent or b-dependent pathway of filamentous growth. Because expression of fuz1 does not appear to increase in the presence of the active bE-bW heterodimer using microarray analysis (M. Vranes and J. Kämper pers comm), it is likely that fuz1 is not a component of the b pathway. Given that fuz1 participates in conjugation tube formation, an a locus-dependent process, it is most likely that fuz1 also participates in the a-dependent autocrine response regulating filamentous growth. Fuz1 is the first member of the fungal MYND domain family of proteins for which a role in the pheromone response has been demonstrated.
Although fuz1 mutants do not form filaments on charcoal agar they form filaments in the plant (Banuett and Herskowitz 1996). This observation led to the hypothesis that alternative pathways for filament formation are activated in the plant. Preliminary evidence indicates that in planta the fuz1 null mutants behave similarly to the UV-induced mutants described by Banuett and Herskowitz (1996). Analysis of the infection process by fuz1 null mutants will be presented elsewhere.
fuz1 is required for events at the junction of cells.— –
Consistent with a requirement for events at the junction of cells we demonstrated that fuz1 mutants exhibit a cell separation defect and cells continue to bud while attached to other cells giving rise to tree-like structures. In addition fuz1 mutants form septa that are aberrant (incomplete) or mislocalized or contain an increased number of septa in the neck region, near it or in the bud. Last, fuz1 mutants fail to constrict the neck region. These phenotypes demonstrate that Fuz1 plays a crucial role in events at the boundary of mother and daughter cell (see below). The tree-like structures formed by fuz1 mutants are somewhat similar to those observed in the don mutants (Sandrock et al 2006, Weinzierl et al 2002), however, the attached cells in the don mutants have a narrow neck similar to that in wild type cells and a single septum. Don1 appears to be a guanine nucleotide exchange factor for the GTPase UmCdc42, and Don3 appears to be a Ste20-like protein (Sandrock et al 2006, Weinzierl et al 2002).
A. nidulans SamB and S. cerevisiae Mub1, two homologues of Fuz1, also exhibit defects at the junction of cells. The samB mutation was isolated as an extragenic suppressor of the nuclear migration defect of apsA mutants (Krüger and Fischer 1996). SamB mutants exhibit mislocalized septa in germlings, and the morphology of the germlings is altered (Krüger and Fischer 1998). Mub1 mutants have a cell separation defect and initiate bud growth before cytokinesis is complete and form clusters of attached cells (Krüeger and Fischer 1998). Taken together these observations indicate that the MYND domain proteins Fuz1, SamB and Mub1 play a crucial role in regulating processes at the junction of cells.
The conclusion that fuz1 is required for events at the junction of cells is further supported by previous observations of fuz1 mutants in planta. Formation of teliospores involves a carefully orchestrated sequence of events in which separation (fragmentation) of hyphal cells to produce individual cylindrical cells appears to be a crucial step (Banuett and Herskowitz 1996). In fuz1 mutants this step is blocked; no teliospores are formed and consequently the life cycle is not completed (Banuett and Herskowitz 1996). We hypothesize that he MYND domain of Fuz1 might mediate interaction with other proteins to control events at the junction of cells during budding and also in filamentous cells during growth in the plant.
Three other proteins, Hgl1 (no matches in the protein databases), Hda1 (histone deacetylase) and Rum1 (similar to human retinoblastoma binding protein 2) are also necessary for teliospore formation; mutants lacking these proteins form tumors devoid of teliospores. hgl1, hda1 and rum1 mutants appear to block a similar step to that blocked in fuz1 mutants, but unlike the latter their hyphae do not show aberrant cytoplasmic protrusions (Dürrenberger et al 2001, Quadbeck-Seeger et al 2000, Reichmann et al 2002). It is not clear whether these genes are necessary specifically for the same step controlled by fuz1 or whether they control events upstream or downstream of fuz1. The rum1 and hda1 mutations do not confer a cell separation defect in yeast-like cells, and hgl1 mutants have a slight defect (Dürrenberger et al 2001, Quadbeck-Seeger et al 2000, Reichmann et al 2002).
In addition to its role in events at the junction of cells, samB like fuz1 also is required for sexual development (Krüger and Fischer 1998). samB mutants are self-sterile; they form fruit bodies but no viable ascospores; the spores lyse inside the cleistothecia (Krüger and Fischer 1998). Spore lysis might be indicative of altered cell wall properties. In U. maydis, fuz1– hyphae form aberrant cytoplasmic protrusions suggestive of a weak cell wall, an observation that supports our conclusions above (see RESULTS) that fuz1 mutants have altered cell wall properties.
Our analysis has shown that the Fuz1 protein is required for cell morphogenesis of the yeast-like cell in U. maydis and that it shares some of its roles with its homologues, SamB of A. nidulans and Mub1 of S. cerevisiae.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Corresponding author. Phone: (562) 985-5535; Fax: (562) 985-8878; E-mail: fbanuett{at}csulb.edu
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Babu MR, Choffe K, Saville BJ. 2005. Differential gene expression in filamentous cells of Ustilago maydis. Curr Genet 47:316–333.[CrossRef][Medline]
Banuett F. 1991. Identification of genes governing filamentous growth and tumor induction by the plant pathogen Ustilago maydis. Proc Nat Acad. Sci USA 88: 3922–3926.[CrossRef]
———. 1995. Genetics of Ustilago maydis, a fungal pathogen that induces tumors in maize. Ann Rev Genet 29:179–208.[CrossRef][Medline]
———. 2002. Pathogenic development in Ustilago maydis: a progression of morphological transitions that results in tumor formation and teliospore production. In: Osiewacz HD, ed. Molecular Biology of Fungal Development. New York: Marcel Dekker. p 349–398.
———. 2007. History of the mating types in Ustilago maydis. In: Heitman J, Kronstad J, Taylor J, Casselton LA, eds. Sex in Fungi: molecular determination and evolutionary implications ASM Press. p 351–375.
———, Herskowitz I. 1989. Different a alleles of Ustilago maydis are necessary for maintenance of filamentous growth but not for meiosis. Proc Nat Acad Sci USA 86: 5878–5882.
———, ———.1994a. Identification of Fuz7, a Ustilago maydis MEK/MAPKK homolog required for a-locus-dependent and -independent steps in the fungal life cycle. Genes Dev 8:1367–1378.
———, ———.1994b. Morphological transitions in the life cycle of Ustilago maydis and their genetic control by the a and b loci. Exp Mycol 18:247–266.[CrossRef]
———, ———.1996. Discrete developmental stages during teliospore formation in the corn smut fungus, Ustilago maydis. Development 122:2965–2976.[Abstract]
———, ———.2002. Bud morphogenesis and the actin and microtubule cytoskeletons during budding in the corn smut fungus, Ustilago maydis. Fungal Genet Biol 37:149–170.[CrossRef][Medline]
Bölker M, Urban M, Kahmann R. 1992. The a mating type locus of U. maydis specifies cell signaling components. Cell 68:441–450.[CrossRef][Medline]
Brachmann A, Konig J, Julius C, Fedbrügge M. 2004. A reverse genetic approach for generating gene replacement mutants in Ustilago maydis. Mol Genet Genomic 272:216–226.
———, Weinzierl G, Kämper J, Kahmann R. 2001. Identification of genes in the bW/bE regulatory cascade in Ustilago maydis. Mol Microbiol 42:1047–1063.[CrossRef][Medline]
Christensen JJ. 1963. Corn smut caused by Ustilago maydis. Am Phytopathol Soc Monogr. No. 2.
Corpet F. 1988. Multiple sequence alignment with hierarchical clustering. Nuc Acid Res 16:10881–10890.
Day PR, Anagnostakis SL, Puhalla JE. 1971. Pathogenicity resulting from mutation at the b locus of Ustilago maydis. Proc Nat Acad Sci USA 68:533–535.
Dürrenberger F, Kronstad JW. 1999. The ukc1 gene encodes a protein kinase involved in morphogenesis, pathogenicity and pigment formation in Ustilago maydis. Mol Gen Genet 261:281–289.[CrossRef][Medline]
———, Laidlaw RD, Kronstad JW. 2001. The hgl1 gene is required for dimorphism and teliospore formation in the fungal pathogen Ustilago maydis. Molec Microbiol 41:337–348.[CrossRef][Medline]
Falquet L, Pagni M, Bucher P, Hulo N, Sigrist CJ, Hofmann K, Bairoch A. 2002. The PROSITE database, its status in 2002. Nuc Acid Res 30:235–238.
Feinstein PG, Kronfeld K, Hogness DS, Mann RS. 1995. Identification of homeotic target genes in Drosophila melanogaster including nervy, a proto-oncogene homologue. Genetics 140:573–586.[Abstract]
Feldbrügge M, Kämper J, Steinberg G, Kahmann R. 2004. Regulation of mating and pathogenic development in Ustilago maydis. Curr Op Microbiol 7:666–672.[CrossRef][Medline]
Fotheringham S, Holloman WK. 1989. Cloning and disruption of Ustilago maydis genes. Molec Cell Biol 9:4052–4055.
Gillissen B, Bergemann J, Sandmann C, Schroeer B, Bölker M, Kahmann R. 1992. A two-component regulatory system for self/non-self recognition in Ustilago maydis. Cell 68:647–657.[CrossRef][Medline]
Gold SE, Duncan G, Barrett K, Kronstad JW. 1994. cAMP regulates morphogenesis in the fungal pathogen Ustilago maydis. Genes Dev 8:2805–2816.
Gross CT, McGinnis W. 1996. DEAF-1, a novel protein that binds an essential region in a Deformed response element. EMBO J 15:1961–1970.[Medline]
Holliday R. 1961. The genetics of Ustilago maydis. Genet Res 2:204–230.[Medline]
———. 1965. Induced mitotic crossing-over in relation to genetic replication in synchronously dividing cells of Ustilago maydis. Genet Res 5:104–120.
———. 1974. Ustilago maydis. In: King RC, ed. Handbook of Genetics. Vol 1. New York: Plenum. p 575–595.
Jacobs CW, Mattichak SJ, Knowles JF. 1994. Budding patterns during the cell cycle of the maize smut pathogen Ustilago maydis. Can J Bot 72:1675–1680.[CrossRef]
Kahmann R, Schirawski J. 2007. Mating in the smut fungi: from a to b to the downstream cascades. In: Heitman J, Kronstad J, Taylor J, Casselton LA, eds. Sex in Fungi: molecular determination and evolutionary implications ASM Press. p 376–386.
Kämper J, Reichmann M, Romeis T, Bölker M, Kahmann R. 1995. Multiallelic recognition: nonself-dependent dimerization of the bE and bW homeodomain proteins in Ustilago maydis. Cell 81:73–83.[CrossRef][Medline]
Keon PR, White GA, Hargreaves JA. 1991. Isolation, characterization and sequence of a gene conferring resistance to the systemic fungicide carboxin from the maize smut pathogen Ustilago maydis. Curr Genet 19:475–481.[CrossRef][Medline]
Klosterman SJ, Perlin MH, Garcia-Pedrajas M, Covert SF, Gold SE. 2007. Genetics of morphogenesis and pathogenic development of Ustilago maydis. Adv Genet 57:1–47.[Medline]
Kojic M, Holloman WK. 2000. Shuttle vectors for genetic manipulations in Ustilago maydis. Can J Microbiol 46: 333–338.[CrossRef][Medline]
Kronstad JW, Leong SA. 1990. The b mating-type locus of Ustilago maydis contains variable and constant regions. Genes Dev 4:1384–1395.
Krüger M, Fischer R. 1996. Isolation of two apsA suppressor strains in Aspergillus nidulans. Genetics 144:533–540.[Abstract]
———, ———.1998. Integrity of a Zn finger-like domain in SamB is crucial for morphogenesis in ascomycetous fungi. EMBO J 17:204–214.[CrossRef][Medline]
Marchler-Bauer A, Anderson JB, Derbuyshire ML, de Weese-Scott C, Gonzalez NZ, Gwadz M, Hao L, He S, Hurwitz DI, et al. 2007. CDD, a conserved domain database for interactive domain family analysis. Nuc Acid Res 35: D237–240.
Miyoshi H, Kozu T, Shimzu K, Enomoto K, Maseki N, Kaneko Y, Kamada N, Ohki M. 1993. The t(8;21) translocation in acute myeloid leukemia results in production of an AML1-MTG8 fusion transcript. EMBO J 12:2715–2721.[Medline]
Nugent KG, Choffe K, Saville BJ. 2004. Gene expression during Ustilago maydis diploid filamentous growth: EST library creation and analysis. Fungal Genet Biol 41: 349–360.[CrossRef][Medline]
O’Donnell KL, McLaughlin KJ. 1984. Postmeiotic mitosis, basidiospore development and septation in Ustilago maydis. Mycologia 76:486–502.[CrossRef]
Puhalla JE. 1968. Compatibility reactions on solid medium and interstrain inhibition in Ustilago maydis. Genetics 60:461–474.
———.1970. Genetic studies of the b incompatibility locus of Ustilago maydis. Genet Res 16:229–232.
Quadbeck-Seeger C, Wanner G, Huber S, Kahmann R, Kämper J. 2000. A protein with similarity to human retinoblastoma binding protein 2 acts specifically as a repressor for genes regulated by the b mating type locus in Ustilago maydis. Mol Microbiol 38:154–166.[CrossRef][Medline]
Ram AF, Klis FM. 2006. Identification of fungal cell wall mutants using susceptibility assays based on Calcofluor white and Congo red. Nat Protoc 1:2253–2256.[CrossRef][Medline]
Regenfelder E, Spellig T, Hartmann A, Lauenstein S, Bölker M, Kahmann R. 1997. G proteins in Ustilago maydis: transmission of multiple signals? EMBO J 16:1934–1942.[CrossRef][Medline]
Reichmann M, Jamnischek A, Weinzierl G, Ladendorf O, Huber S, ———, Kämper J. 2002. The histone deacetylase Hda1 from Ustilago maydis is essential for teliospore development. Mol Microbiol 46:1169–1182.[CrossRef][Medline]
Roncero C, Duran A. 1985. Effect of Calcofluor white and Congo red on fungal cell wall morphogenesis: in vivo activation of chitin polymerization. J Bacteriol 162: 1180–1185.
Rowell JB, DeVay JE. 1954. Genetics of Ustilago zeae in relation to basic problems of its pathogenicity. Phytopathology 44:356–362.
Ruiz-Herrera J, Leon CG, Guevara-Olvera L, Carabez-Trejo A. 1995. Yeast-mycelial dimorphism of haploid and diploid strains of Ustilago maydis. Microbiology 141: 695–703.
———, León-Ramírez C, Cabrera-Ponce JL, Martínez-Espinoza AD, Herrera-Estrella L. 1999. Completion of the sexual cycle and demonstration of genetic recombination in Ustilago maydis in vitro. Mol Gen Genet 262:468–472.[CrossRef][Medline]
Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor, New York: Cold Spring. 999 p.
Sandrock B, Böhmer C, Bölker M. 2006. Dual function of the germinal centre kinase Don3 during mitosis and cytokinesis in Ustilago maydis. Mol Microbiol 62:655–666.[CrossRef][Medline]
Schulz B, Banuett F, Dahl M, Schlesinger R, Schäfer W, Martin T, Herskowitz I, Kahmann R. 1990. The b alleles of U. maydis, whose combinations program pathogenic development, code for polypeptides containing a homeodomain-related motif. Cell 60:295–306.[CrossRef][Medline]
Snetselaar KM, Bölker M, Kahmann R. 1996. Ustilago maydis mating hyphae orient their growth toward pheromone sources. Fungal Genet Biol 20:299–312.[CrossRef][Medline]
———, Mims CW. 1994. Light and electron-microscopy of Ustilago maydis hyphae in maize. Mycol Res 98:347–355.
Spadaccini R, Perrin H, Bottomley MJ, Ansieau S, Sattler M. 2006. Structure and functional analysis of the MYND domain. J Mol Biol 358:498–508.[CrossRef][Medline]
Spellig T, Bölker M, Lottspeich F, Frank RW, Kahmann R. 1994. Pheromones trigger filamentous growth in Ustilago maydis. EMBO J 13:1620–1627.[Medline]
Steinberg G, Wedlich-Söldner R, Brill M, Schulz I. 2001. Microtubules in the fungal pathogen Ustilago maydis are highly dynamic and determine cell polarity. J Cell Sci 114:609–622.[Abstract]
Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighing, position-specific gap penalties and weight matrix choice. Nuc Acid Res 22:4673–4680.
Tsukuda T, Carleton S, Fotheringham S, Holloman WK. 1988. Isolation and characterization of an autonomously replicating sequence from Ustilago maydis. Mol Cell Biol 8:3703–3709.
Wang J, Holden DW, Leong SA. 1988. Gene transfer system for the phytopathogenic fungus Ustilago maydis. Proc Nat Acad Sci USA 85:865–869.
Weinzierl G, Leveleki L, Hassel A, Kost G, Wanner G, Bölker M. 2002. Regulation of cell separation in the dimorphic fungus Ustilago maydis. Mol Microbiol 45:219–231.[CrossRef][Medline]
Yee AR, Kronstad JW. 1998. Dual sets of chimeric alleles identify specificity sequences for the bE and bW mating and pathogenicity genes of Ustilago maydis. Mol Cell Biol 18:221–232.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
